Incidental Mutation 'R5618:Smchd1'
ID439672
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene NameSMC hinge domain containing 1
Synonyms4931400A14Rik, MommeD1
MMRRC Submission 043277-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R5618 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71344489-71475343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71455727 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 172 (D172E)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430] [ENSMUST00000183937]
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: D172E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: D172E

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171504
Predicted Effect probably benign
Transcript: ENSMUST00000183937
SMART Domains Protein: ENSMUSP00000139241
Gene: ENSMUSG00000091831

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik G A 5: 107,548,199 W167* probably null Het
Acvr1 C T 2: 58,462,943 R335Q probably damaging Het
Atg7 A G 6: 114,673,699 D67G probably damaging Het
Avil T C 10: 127,010,577 F417S possibly damaging Het
AW551984 A T 9: 39,590,704 L702Q probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Bcl7a A T 5: 123,361,202 N95Y probably damaging Het
Cblb A G 16: 52,152,668 D454G possibly damaging Het
Cc2d2a A T 5: 43,729,907 Q1226H probably benign Het
Cct5 A G 15: 31,598,015 S13P possibly damaging Het
Clca1 C T 3: 145,004,977 E822K probably benign Het
Csgalnact2 A T 6: 118,126,316 D228E probably damaging Het
Defb12 A T 8: 19,114,798 M8K possibly damaging Het
Dysf A G 6: 84,106,824 D736G probably benign Het
Exog G T 9: 119,462,751 D365Y probably damaging Het
Fam222b T G 11: 78,154,240 V81G probably benign Het
Fam69b T C 2: 26,634,875 S96P probably damaging Het
Fbl A G 7: 28,178,986 E301G probably damaging Het
Fez1 A T 9: 36,843,932 N76Y probably damaging Het
Gm13103 A T 4: 143,850,693 E15V possibly damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
H2-Q4 T A 17: 35,379,925 F57Y probably damaging Het
Ift88 T C 14: 57,481,508 I650T possibly damaging Het
Kif1b A T 4: 149,269,889 D231E possibly damaging Het
Lig4 A T 8: 9,972,021 D586E probably benign Het
Mlc1 C A 15: 88,974,566 L126F probably damaging Het
Muc4 A G 16: 32,754,253 T1376A probably benign Het
Ncoa6 A T 2: 155,437,897 D66E possibly damaging Het
Olfr522 A G 7: 140,162,272 V226A probably damaging Het
Olfr907 C T 9: 38,498,740 Q24* probably null Het
Pard6a T C 8: 105,702,914 V168A probably damaging Het
Pmpcb A G 5: 21,742,788 N163S possibly damaging Het
Prdm2 C T 4: 143,133,537 C1061Y probably benign Het
Prkdc A G 16: 15,809,612 Y3378C probably damaging Het
Sema6a A T 18: 47,281,948 V425E probably damaging Het
Sema7a A T 9: 57,960,283 E439D possibly damaging Het
Serpinf1 T A 11: 75,410,184 T402S possibly damaging Het
Sf3a2 T C 10: 80,804,576 probably benign Het
Spag5 T G 11: 78,304,080 I71S probably benign Het
Spata31d1d G A 13: 59,726,400 A1107V probably benign Het
Svep1 A C 4: 58,070,537 S2416R probably benign Het
Tbc1d9 A G 8: 83,242,592 Y503C probably damaging Het
Tlr9 A T 9: 106,224,739 I410F possibly damaging Het
Tmem87a C A 2: 120,369,306 L452F probably benign Het
Tmprss11d A T 5: 86,306,295 M217K probably benign Het
Ttc37 T A 13: 76,173,426 S1346T probably benign Het
Vmn2r80 T C 10: 79,148,921 Y36H probably benign Het
Vmn2r87 A T 10: 130,479,948 F83Y probably damaging Het
Vmp1 C T 11: 86,663,562 R75H probably benign Het
Wapl T A 14: 34,691,906 Y242N possibly damaging Het
Zfp473 T A 7: 44,741,732 D6V probably benign Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAGCACACTAGAGTTCTTACCC -3'
(R):5'- CGTTTGATAGATATGATTCAGTGCC -3'

Sequencing Primer
(F):5'- CCTTTCAAAGTCACCTTGTC -3'
(R):5'- GTCCTGGAACTAACTCTGTAGAGC -3'
Posted On2016-11-08