Incidental Mutation 'R0496:Wdfy4'
ID43968
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 33140738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect probably benign
Transcript: ENSMUST00000061753
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130509
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
St6gal2 A G 17: 55,482,014 I16M probably damaging Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
dodgers UTSW 14 32977106 nonsense probably null
Dollar UTSW 14 33020311 missense probably damaging 1.00
Giants UTSW 14 33070618 nonsense probably null
gigantea UTSW 14 32974154 critical splice donor site probably null
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7101:Wdfy4 UTSW 14 32960820 missense
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7324:Wdfy4 UTSW 14 33047314 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33090963 missense
R7946:Wdfy4 UTSW 14 33070748 missense
R7946:Wdfy4 UTSW 14 33104115 missense
R7986:Wdfy4 UTSW 14 33104115 missense
R7990:Wdfy4 UTSW 14 33097795 missense
R8001:Wdfy4 UTSW 14 32973535 critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32971627 missense
R8015:Wdfy4 UTSW 14 33107747 missense
R8032:Wdfy4 UTSW 14 33029086 nonsense probably null
R8041:Wdfy4 UTSW 14 33154008 critical splice donor site probably null
R8090:Wdfy4 UTSW 14 33104115 missense
R8092:Wdfy4 UTSW 14 33104115 missense
R8112:Wdfy4 UTSW 14 33104115 missense
R8114:Wdfy4 UTSW 14 33104115 missense
R8115:Wdfy4 UTSW 14 33104115 missense
R8117:Wdfy4 UTSW 14 32977106 nonsense probably null
R8117:Wdfy4 UTSW 14 33104115 missense
R8118:Wdfy4 UTSW 14 33104115 missense
R8140:Wdfy4 UTSW 14 33142360 missense
R8155:Wdfy4 UTSW 14 33162819 missense
R8163:Wdfy4 UTSW 14 33151588 missense
R8293:Wdfy4 UTSW 14 32974261 missense
R8325:Wdfy4 UTSW 14 32967487 missense
R8370:Wdfy4 UTSW 14 33093251 missense
R8437:Wdfy4 UTSW 14 33076375 missense
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Z1177:Wdfy4 UTSW 14 33087985 missense
Predicted Primers PCR Primer
(F):5'- CCCAGTGCATGAAGGAAGATGAGTC -3'
(R):5'- GAATGAGGTTGATCACTCCAGGGC -3'

Sequencing Primer
(F):5'- GGACTTGACCTCACCTTGAGAAG -3'
(R):5'- acattgtcattaactttaggcatttg -3'
Posted On2013-05-29