Incidental Mutation 'R5619:Pfkfb3'
ID439683
Institutional Source Beutler Lab
Gene Symbol Pfkfb3
Ensembl Gene ENSMUSG00000026773
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
SynonymsE330010H22Rik, uPFK-2
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11471433-11554077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11484659 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 276 (K276R)
Ref Sequence ENSEMBL: ENSMUSP00000110495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028114] [ENSMUST00000049849] [ENSMUST00000100411] [ENSMUST00000114844] [ENSMUST00000114845] [ENSMUST00000114846] [ENSMUST00000170196] [ENSMUST00000171188] [ENSMUST00000179584] [ENSMUST00000183869] [ENSMUST00000191668] [ENSMUST00000192949] [ENSMUST00000195779]
Predicted Effect probably benign
Transcript: ENSMUST00000028114
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028114
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049849
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050926
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.3e-110 PFAM
Pfam:KTI12 36 218 9.7e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100411
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097979
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 5.8e-110 PFAM
Pfam:KTI12 36 219 9.6e-9 PFAM
Pfam:AAA_33 37 191 2.4e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114844
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114845
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110494
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114846
AA Change: K276R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110495
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.1e-110 PFAM
Pfam:KTI12 36 219 9e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150086
Predicted Effect probably benign
Transcript: ENSMUST00000170196
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126305
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.4e-110 PFAM
Pfam:KTI12 36 218 9.9e-9 PFAM
Pfam:AAA_33 37 191 2e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171188
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179584
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137130
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183869
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138893
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191668
AA Change: K276R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142079
Gene: ENSMUSG00000026773
AA Change: K276R

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.6e-110 PFAM
Pfam:KTI12 36 218 1e-8 PFAM
Pfam:AAA_33 37 191 2.1e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192844
Predicted Effect probably benign
Transcript: ENSMUST00000192949
AA Change: K256R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142296
Gene: ENSMUSG00000026773
AA Change: K256R

DomainStartEndE-ValueType
Pfam:6PF2K 3 226 1.9e-107 PFAM
Pfam:KTI12 16 200 3.9e-6 PFAM
Pfam:AAA_33 17 171 1.9e-8 PFAM
PGAM 228 375 3.8e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195779
AA Change: K272R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141445
Gene: ENSMUSG00000026773
AA Change: K272R

DomainStartEndE-ValueType
Pfam:6PF2K 3 159 1.3e-69 PFAM
Pfam:KTI12 16 212 1.8e-6 PFAM
Pfam:AAA_33 17 163 1.6e-9 PFAM
Pfam:6PF2K 158 242 2.2e-32 PFAM
Pfam:His_Phos_1 244 326 3.4e-13 PFAM
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before E8 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Pfkfb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pfkfb3 APN 2 11488754 missense probably damaging 1.00
IGL01651:Pfkfb3 APN 2 11489684 missense probably damaging 0.97
IGL02010:Pfkfb3 APN 2 11483994 missense probably benign
IGL02546:Pfkfb3 APN 2 11488778 missense probably damaging 1.00
IGL03182:Pfkfb3 APN 2 11501663 missense probably damaging 0.99
R1491:Pfkfb3 UTSW 2 11493936 missense probably damaging 1.00
R2365:Pfkfb3 UTSW 2 11493902 critical splice donor site probably null
R2919:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R2920:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R4709:Pfkfb3 UTSW 2 11493908 missense probably damaging 1.00
R4863:Pfkfb3 UTSW 2 11486312 missense probably benign
R4915:Pfkfb3 UTSW 2 11490298 nonsense probably null
R5087:Pfkfb3 UTSW 2 11484014 missense probably damaging 1.00
R5109:Pfkfb3 UTSW 2 11486351 splice site probably benign
R5244:Pfkfb3 UTSW 2 11484849 missense probably damaging 1.00
R5488:Pfkfb3 UTSW 2 11484669 missense probably benign 0.00
R5573:Pfkfb3 UTSW 2 11501672 missense probably benign 0.28
R5757:Pfkfb3 UTSW 2 11480330 missense probably damaging 0.99
R6015:Pfkfb3 UTSW 2 11481335 critical splice acceptor site probably null
R7495:Pfkfb3 UTSW 2 11482501 missense probably damaging 1.00
R7688:Pfkfb3 UTSW 2 11492639 missense probably damaging 1.00
R7813:Pfkfb3 UTSW 2 11481908 missense probably benign 0.12
X0024:Pfkfb3 UTSW 2 11482555 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTATCAGAGTCCAAGAGGCCCG -3'
(R):5'- CAAAGTGATTGATGTTGGCCGG -3'

Sequencing Primer
(F):5'- GTCCAAGAGGCCCGACTCTAC -3'
(R):5'- GATGAACATCCACGTGCA -3'
Posted On2016-11-08