Incidental Mutation 'R5619:Itga8'
ID 439684
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 043278-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R5619 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12270139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 116 (R116W)
Ref Sequence ENSEMBL: ENSMUSP00000134154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably damaging
Transcript: ENSMUST00000028106
AA Change: R116W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: R116W

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141477
Predicted Effect probably damaging
Transcript: ENSMUST00000172791
AA Change: R116W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: R116W

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Adgre1 T G 17: 57,727,437 (GRCm39) L456V probably benign Het
Adgrv1 C T 13: 81,620,619 (GRCm39) G3943R probably damaging Het
Akap9 A G 5: 4,004,760 (GRCm39) probably benign Het
Atp1a2 T A 1: 172,106,948 (GRCm39) I791F probably damaging Het
BC004004 C G 17: 29,501,703 (GRCm39) P81A probably damaging Het
Brca2 C A 5: 150,480,579 (GRCm39) T2755K probably damaging Het
Cacna1c T C 6: 118,719,322 (GRCm39) D215G probably damaging Het
Ccdc142 C T 6: 83,080,603 (GRCm39) S445F probably benign Het
Comt T C 16: 18,230,469 (GRCm39) E80G probably damaging Het
Coq7 T C 7: 118,126,709 (GRCm39) probably benign Het
Coro7 C A 16: 4,494,799 (GRCm39) probably null Het
Cyp2c40 A G 19: 39,792,228 (GRCm39) S239P probably damaging Het
Dnah5 T C 15: 28,302,581 (GRCm39) S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 (GRCm39) I2193M probably benign Het
Eipr1 A G 12: 28,917,078 (GRCm39) Y382C probably damaging Het
Fastkd2 T A 1: 63,778,469 (GRCm39) H447Q probably benign Het
Galk2 A T 2: 125,817,317 (GRCm39) R369* probably null Het
Gli2 G A 1: 118,764,485 (GRCm39) A1222V probably benign Het
Golim4 T A 3: 75,813,802 (GRCm39) K141* probably null Het
Gtpbp3 G T 8: 71,943,692 (GRCm39) probably benign Het
Gzmd C T 14: 56,367,224 (GRCm39) A223T probably benign Het
Igf2r T C 17: 12,958,221 (GRCm39) R151G probably damaging Het
Klhdc1 T G 12: 69,304,919 (GRCm39) probably null Het
Klhl25 T C 7: 75,516,602 (GRCm39) Y198H probably benign Het
Klhl29 A T 12: 5,190,587 (GRCm39) M136K probably benign Het
Lipf A T 19: 33,944,292 (GRCm39) Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 (GRCm39) K39E possibly damaging Het
Mbtd1 T A 11: 93,820,705 (GRCm39) probably null Het
Myo1a T A 10: 127,554,413 (GRCm39) N794K probably benign Het
Nmrk1 T C 19: 18,622,452 (GRCm39) L177P possibly damaging Het
Noxa1 C T 2: 24,975,988 (GRCm39) E401K probably damaging Het
Or10g9b T A 9: 39,918,039 (GRCm39) M69L probably benign Het
Or4f53 A T 2: 111,087,856 (GRCm39) Y132F probably damaging Het
Ostm1 T A 10: 42,555,325 (GRCm39) C116S probably damaging Het
Pcdhga7 T C 18: 37,848,800 (GRCm39) I269T probably benign Het
Pfkfb3 T C 2: 11,489,470 (GRCm39) K276R probably benign Het
Pfkp A T 13: 6,648,765 (GRCm39) probably benign Het
Pitpnm1 A G 19: 4,153,270 (GRCm39) D142G probably damaging Het
Pkp3 T C 7: 140,668,419 (GRCm39) L556P probably damaging Het
Plb1 C A 5: 32,490,841 (GRCm39) T1046N probably damaging Het
Plxnb2 T C 15: 89,047,012 (GRCm39) S770G possibly damaging Het
Polk A T 13: 96,620,064 (GRCm39) I733N probably damaging Het
Potegl T C 2: 23,147,017 (GRCm39) probably null Het
Prkg2 C A 5: 99,136,156 (GRCm39) C301F probably damaging Het
Rabgap1l T C 1: 160,066,142 (GRCm39) T189A probably benign Het
Raph1 T C 1: 60,529,414 (GRCm39) probably benign Het
Rbm22 T A 18: 60,693,899 (GRCm39) M1K probably null Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rnf186 T A 4: 138,694,715 (GRCm39) I85N probably benign Het
Ryr2 C A 13: 11,723,088 (GRCm39) R2517L probably damaging Het
Sec63 T A 10: 42,665,378 (GRCm39) Y103N probably damaging Het
Serpinb3a G A 1: 106,974,838 (GRCm39) P232S probably damaging Het
Slco6d1 C A 1: 98,423,947 (GRCm39) T533K probably damaging Het
Smarcad1 T A 6: 65,088,865 (GRCm39) D1000E probably benign Het
Spata46 A T 1: 170,136,490 (GRCm39) I14F probably damaging Het
Speer4b T C 5: 27,703,815 (GRCm39) H106R possibly damaging Het
Spint4 T C 2: 164,542,761 (GRCm39) L118P probably benign Het
Sptbn5 A G 2: 119,880,613 (GRCm39) noncoding transcript Het
Tgfbr3 A T 5: 107,288,380 (GRCm39) I427N probably benign Het
Thbs2 C A 17: 14,901,506 (GRCm39) C491F probably damaging Het
Tmem232 T A 17: 65,793,506 (GRCm39) E64D probably benign Het
Tnpo3 A T 6: 29,565,197 (GRCm39) C585* probably null Het
Ttc13 A T 8: 125,406,683 (GRCm39) probably benign Het
Tuba8 C T 6: 121,202,854 (GRCm39) A389V probably damaging Het
Uqcc4 G A 17: 25,403,963 (GRCm39) S101N probably damaging Het
Usp25 A G 16: 76,830,833 (GRCm39) I30V probably benign Het
Vmn2r31 T A 7: 7,387,529 (GRCm39) K681* probably null Het
Vmn2r88 A G 14: 51,651,367 (GRCm39) E235G probably damaging Het
Vps29 T A 5: 122,492,511 (GRCm39) probably benign Het
Wdr1 A C 5: 38,686,879 (GRCm39) V568G possibly damaging Het
Zfp64 T G 2: 168,741,734 (GRCm39) Q398P probably damaging Het
Zfp64 G T 2: 168,741,735 (GRCm39) Q398K probably damaging Het
Zfp839 T C 12: 110,830,470 (GRCm39) Y398H probably damaging Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAGCTGCCAATAAGTCTATCAATG -3'
(R):5'- GGGTTACACCTATGGAGTGAC -3'

Sequencing Primer
(F):5'- GTTCCATGACCCGTTCAT -3'
(R):5'- AATCAGGGTAATTCTGGCCC -3'
Posted On 2016-11-08