Mutagenetix > Incidental Mutation

Incidental Mutation 'R5619:Itga8'

439684

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

043278-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R5619 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12265328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 116 (R116W)

Ref Sequence

ENSEMBL: ENSMUSP00000134154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028106
AA Change: R116W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: R116W

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141477

Predicted Effect

probably damaging
Transcript: ENSMUST00000172791
AA Change: R116W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: R116W

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.7%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4931423N10Rik	T	C	2: 23,257,005		probably null	Het
Adgre1	T	G	17: 57,420,437	L456V	probably benign	Het
Adgrv1	C	T	13: 81,472,500	G3943R	probably damaging	Het
Akap9	A	G	5: 3,954,760		probably benign	Het
Atp1a2	T	A	1: 172,279,381	I791F	probably damaging	Het
BC003965	G	A	17: 25,184,989	S101N	probably damaging	Het
BC004004	C	G	17: 29,282,729	P81A	probably damaging	Het
Brca2	C	A	5: 150,557,114	T2755K	probably damaging	Het
Cacna1c	T	C	6: 118,742,361	D215G	probably damaging	Het
Ccdc142	C	T	6: 83,103,622	S445F	probably benign	Het
Comt	T	C	16: 18,411,719	E80G	probably damaging	Het
Coq7	T	C	7: 118,527,486		probably benign	Het
Coro7	C	A	16: 4,676,935		probably null	Het
Cyp2c40	A	G	19: 39,803,784	S239P	probably damaging	Het
Dnah5	T	C	15: 28,302,435	S1613P	probably damaging	Het
Dync2h1	T	C	9: 7,118,885	I2193M	probably benign	Het
Eipr1	A	G	12: 28,867,079	Y382C	probably damaging	Het
Fastkd2	T	A	1: 63,739,310	H447Q	probably benign	Het
Galk2	A	T	2: 125,975,397	R369*	probably null	Het
Gli2	G	A	1: 118,836,755	A1222V	probably benign	Het
Golim4	T	A	3: 75,906,495	K141*	probably null	Het
Gtpbp3	G	T	8: 71,491,048		probably benign	Het
Gzmd	C	T	14: 56,129,767	A223T	probably benign	Het
Igf2r	T	C	17: 12,739,334	R151G	probably damaging	Het
Klhdc1	T	G	12: 69,258,145		probably null	Het
Klhl25	T	C	7: 75,866,854	Y198H	probably benign	Het
Klhl29	A	T	12: 5,140,587	M136K	probably benign	Het
Lipf	A	T	19: 33,966,892	Y167F	possibly damaging	Het
Lpar1	T	C	4: 58,487,155	K39E	possibly damaging	Het
Mbtd1	T	A	11: 93,929,879		probably null	Het
Myo1a	T	A	10: 127,718,544	N794K	probably benign	Het
Nmrk1	T	C	19: 18,645,088	L177P	possibly damaging	Het
Noxa1	C	T	2: 25,085,976	E401K	probably damaging	Het
Olfr1276	A	T	2: 111,257,511	Y132F	probably damaging	Het
Olfr980	T	A	9: 40,006,743	M69L	probably benign	Het
Ostm1	T	A	10: 42,679,329	C116S	probably damaging	Het
Pcdhga7	T	C	18: 37,715,747	I269T	probably benign	Het
Pfkfb3	T	C	2: 11,484,659	K276R	probably benign	Het
Pfkp	A	T	13: 6,598,729		probably benign	Het
Pitpnm1	A	G	19: 4,103,270	D142G	probably damaging	Het
Pkp3	T	C	7: 141,088,506	L556P	probably damaging	Het
Plb1	C	A	5: 32,333,497	T1046N	probably damaging	Het
Plxnb2	T	C	15: 89,162,809	S770G	possibly damaging	Het
Polk	A	T	13: 96,483,556	I733N	probably damaging	Het
Prkg2	C	A	5: 98,988,297	C301F	probably damaging	Het
Rabgap1l	T	C	1: 160,238,572	T189A	probably benign	Het
Raph1	T	C	1: 60,490,255		probably benign	Het
Rbm22	T	A	18: 60,560,827	M1K	probably null	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rnf186	T	A	4: 138,967,404	I85N	probably benign	Het
Ryr2	C	A	13: 11,708,202	R2517L	probably damaging	Het
Sec63	T	A	10: 42,789,382	Y103N	probably damaging	Het
Serpinb3a	G	A	1: 107,047,108	P232S	probably damaging	Het
Slco6d1	C	A	1: 98,496,222	T533K	probably damaging	Het
Smarcad1	T	A	6: 65,111,881	D1000E	probably benign	Het
Spata46	A	T	1: 170,308,921	I14F	probably damaging	Het
Speer4b	T	C	5: 27,498,817	H106R	possibly damaging	Het
Spint4	T	C	2: 164,700,841	L118P	probably benign	Het
Sptbn5	A	G	2: 120,050,132		noncoding transcript	Het
Tgfbr3	A	T	5: 107,140,514	I427N	probably benign	Het
Thbs2	C	A	17: 14,681,244	C491F	probably damaging	Het
Tmem232	T	A	17: 65,486,511	E64D	probably benign	Het
Tnpo3	A	T	6: 29,565,198	C585*	probably null	Het
Ttc13	A	T	8: 124,679,944		probably benign	Het
Tuba8	C	T	6: 121,225,895	A389V	probably damaging	Het
Usp25	A	G	16: 77,033,945	I30V	probably benign	Het
Vmn2r31	T	A	7: 7,384,530	K681*	probably null	Het
Vmn2r88	A	G	14: 51,413,910	E235G	probably damaging	Het
Vps29	T	A	5: 122,354,448		probably benign	Het
Wdr1	A	C	5: 38,529,536	V568G	possibly damaging	Het
Zfp64	T	G	2: 168,899,814	Q398P	probably damaging	Het
Zfp64	G	T	2: 168,899,815	Q398K	probably damaging	Het
Zfp839	T	C	12: 110,864,036	Y398H	probably damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GAGCTGCCAATAAGTCTATCAATG -3'
(R):5'- GGGTTACACCTATGGAGTGAC -3'

Sequencing Primer
(F):5'- GTTCCATGACCCGTTCAT -3'
(R):5'- AATCAGGGTAATTCTGGCCC -3'

Posted On

2016-11-08