Mutagenetix > Incidental Mutations

Incidental Mutation 'R5619:Plb1'

439700

Institutional Source

Beutler Lab

Gene Symbol

Plb1

Ensembl Gene

ENSMUSG00000029134

Gene Name

phospholipase B1

Synonyms

4930539A06Rik, 4632413E21Rik, 4930433E17Rik

MMRRC Submission

043278-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R5619 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32232708-32366520 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 32333497 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 1046 (T1046N)

Ref Sequence

ENSEMBL: ENSMUSP00000144040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]

Predicted Effect

probably damaging
Transcript: ENSMUST00000101376
AA Change: T1046N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: T1046N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202220
AA Change: T1046N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: T1046N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202886

Meta Mutation Damage Score

0.1014

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.7%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4931423N10Rik	T	C	2: 23,257,005		probably null	Het
Adgre1	T	G	17: 57,420,437	L456V	probably benign	Het
Adgrv1	C	T	13: 81,472,500	G3943R	probably damaging	Het
Akap9	A	G	5: 3,954,760		probably benign	Het
Atp1a2	T	A	1: 172,279,381	I791F	probably damaging	Het
BC003965	G	A	17: 25,184,989	S101N	probably damaging	Het
BC004004	C	G	17: 29,282,729	P81A	probably damaging	Het
Brca2	C	A	5: 150,557,114	T2755K	probably damaging	Het
Cacna1c	T	C	6: 118,742,361	D215G	probably damaging	Het
Ccdc142	C	T	6: 83,103,622	S445F	probably benign	Het
Comt	T	C	16: 18,411,719	E80G	probably damaging	Het
Coq7	T	C	7: 118,527,486		probably benign	Het
Coro7	C	A	16: 4,676,935		probably null	Het
Cyp2c40	A	G	19: 39,803,784	S239P	probably damaging	Het
Dnah5	T	C	15: 28,302,435	S1613P	probably damaging	Het
Dync2h1	T	C	9: 7,118,885	I2193M	probably benign	Het
Eipr1	A	G	12: 28,867,079	Y382C	probably damaging	Het
Fastkd2	T	A	1: 63,739,310	H447Q	probably benign	Het
Galk2	A	T	2: 125,975,397	R369*	probably null	Het
Gli2	G	A	1: 118,836,755	A1222V	probably benign	Het
Golim4	T	A	3: 75,906,495	K141*	probably null	Het
Gtpbp3	G	T	8: 71,491,048		probably benign	Het
Gzmd	C	T	14: 56,129,767	A223T	probably benign	Het
Igf2r	T	C	17: 12,739,334	R151G	probably damaging	Het
Itga8	T	A	2: 12,265,328	R116W	probably damaging	Het
Klhdc1	T	G	12: 69,258,145		probably null	Het
Klhl25	T	C	7: 75,866,854	Y198H	probably benign	Het
Klhl29	A	T	12: 5,140,587	M136K	probably benign	Het
Lipf	A	T	19: 33,966,892	Y167F	possibly damaging	Het
Lpar1	T	C	4: 58,487,155	K39E	possibly damaging	Het
Mbtd1	T	A	11: 93,929,879		probably null	Het
Myo1a	T	A	10: 127,718,544	N794K	probably benign	Het
Nmrk1	T	C	19: 18,645,088	L177P	possibly damaging	Het
Noxa1	C	T	2: 25,085,976	E401K	probably damaging	Het
Olfr1276	A	T	2: 111,257,511	Y132F	probably damaging	Het
Olfr980	T	A	9: 40,006,743	M69L	probably benign	Het
Ostm1	T	A	10: 42,679,329	C116S	probably damaging	Het
Pcdhga7	T	C	18: 37,715,747	I269T	probably benign	Het
Pfkfb3	T	C	2: 11,484,659	K276R	probably benign	Het
Pfkp	A	T	13: 6,598,729		probably benign	Het
Pitpnm1	A	G	19: 4,103,270	D142G	probably damaging	Het
Pkp3	T	C	7: 141,088,506	L556P	probably damaging	Het
Plxnb2	T	C	15: 89,162,809	S770G	possibly damaging	Het
Polk	A	T	13: 96,483,556	I733N	probably damaging	Het
Prkg2	C	A	5: 98,988,297	C301F	probably damaging	Het
Rabgap1l	T	C	1: 160,238,572	T189A	probably benign	Het
Raph1	T	C	1: 60,490,255		probably benign	Het
Rbm22	T	A	18: 60,560,827	M1K	probably null	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rnf186	T	A	4: 138,967,404	I85N	probably benign	Het
Ryr2	C	A	13: 11,708,202	R2517L	probably damaging	Het
Sec63	T	A	10: 42,789,382	Y103N	probably damaging	Het
Serpinb3a	G	A	1: 107,047,108	P232S	probably damaging	Het
Slco6d1	C	A	1: 98,496,222	T533K	probably damaging	Het
Smarcad1	T	A	6: 65,111,881	D1000E	probably benign	Het
Spata46	A	T	1: 170,308,921	I14F	probably damaging	Het
Speer4b	T	C	5: 27,498,817	H106R	possibly damaging	Het
Spint4	T	C	2: 164,700,841	L118P	probably benign	Het
Sptbn5	A	G	2: 120,050,132		noncoding transcript	Het
Tgfbr3	A	T	5: 107,140,514	I427N	probably benign	Het
Thbs2	C	A	17: 14,681,244	C491F	probably damaging	Het
Tmem232	T	A	17: 65,486,511	E64D	probably benign	Het
Tnpo3	A	T	6: 29,565,198	C585*	probably null	Het
Ttc13	A	T	8: 124,679,944		probably benign	Het
Tuba8	C	T	6: 121,225,895	A389V	probably damaging	Het
Usp25	A	G	16: 77,033,945	I30V	probably benign	Het
Vmn2r31	T	A	7: 7,384,530	K681*	probably null	Het
Vmn2r88	A	G	14: 51,413,910	E235G	probably damaging	Het
Vps29	T	A	5: 122,354,448		probably benign	Het
Wdr1	A	C	5: 38,529,536	V568G	possibly damaging	Het
Zfp64	T	G	2: 168,899,814	Q398P	probably damaging	Het
Zfp64	G	T	2: 168,899,815	Q398K	probably damaging	Het
Zfp839	T	C	12: 110,864,036	Y398H	probably damaging	Het

Other mutations in Plb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Plb1	APN	5	32345736	missense	probably benign	0.00
IGL00542:Plb1	APN	5	32269834	missense	probably benign	0.02
IGL00835:Plb1	APN	5	32364172	missense	unknown
IGL00954:Plb1	APN	5	32298514	splice site	probably benign
IGL01350:Plb1	APN	5	32317064	missense	probably damaging	1.00
IGL01527:Plb1	APN	5	32317123	missense	probably damaging	1.00
IGL01599:Plb1	APN	5	32342544	splice site	probably benign
IGL01690:Plb1	APN	5	32313697	missense	probably damaging	1.00
IGL01813:Plb1	APN	5	32329085	missense	probably damaging	1.00
IGL01826:Plb1	APN	5	32281145	missense	probably damaging	0.99
IGL02263:Plb1	APN	5	32321348	splice site	probably benign
IGL02314:Plb1	APN	5	32281148	missense	possibly damaging	0.93
IGL02649:Plb1	APN	5	32362568	missense	probably benign	0.09
IGL02701:Plb1	APN	5	32364197	missense	unknown
IGL02704:Plb1	APN	5	32353667	missense	probably benign	0.03
IGL03170:Plb1	APN	5	32284902	missense	probably damaging	0.99
IGL03182:Plb1	APN	5	32344915	splice site	probably benign
IGL03326:Plb1	APN	5	32331327	missense	probably benign	0.00
IGL03046:Plb1	UTSW	5	32328412	missense	probably damaging	1.00
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0330:Plb1	UTSW	5	32355357	missense	probably damaging	1.00
R0413:Plb1	UTSW	5	32355362	missense	probably damaging	1.00
R0721:Plb1	UTSW	5	32364195	missense	unknown
R0735:Plb1	UTSW	5	32284920	missense	possibly damaging	0.90
R1423:Plb1	UTSW	5	32293257	missense	probably benign
R1428:Plb1	UTSW	5	32264912	missense	possibly damaging	0.82
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1694:Plb1	UTSW	5	32317277	missense	probably null	0.01
R1801:Plb1	UTSW	5	32293243	missense	probably damaging	1.00
R1804:Plb1	UTSW	5	32353697	missense	possibly damaging	0.91
R1900:Plb1	UTSW	5	32286847	missense	probably benign	0.44
R1903:Plb1	UTSW	5	32291238	missense	probably damaging	1.00
R2101:Plb1	UTSW	5	32349660	missense	probably damaging	1.00
R2153:Plb1	UTSW	5	32314089	missense	probably damaging	1.00
R2207:Plb1	UTSW	5	32316640	missense	possibly damaging	0.50
R2270:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2271:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2311:Plb1	UTSW	5	32269818	missense	probably benign	0.01
R2850:Plb1	UTSW	5	32293224	missense	probably benign
R3103:Plb1	UTSW	5	32328029	missense	possibly damaging	0.92
R4444:Plb1	UTSW	5	32330565	missense	probably benign	0.06
R4559:Plb1	UTSW	5	32332831	missense	probably damaging	0.99
R4577:Plb1	UTSW	5	32247557	nonsense	probably null
R4578:Plb1	UTSW	5	32247557	nonsense	probably null
R4739:Plb1	UTSW	5	32349679	splice site	probably null
R4747:Plb1	UTSW	5	32349659	missense	probably benign	0.08
R4806:Plb1	UTSW	5	32289852	missense	probably damaging	1.00
R5406:Plb1	UTSW	5	32341915	missense	probably damaging	1.00
R5567:Plb1	UTSW	5	32364199	missense	unknown
R5574:Plb1	UTSW	5	32329947	missense	probably benign	0.13
R5588:Plb1	UTSW	5	32329949	critical splice donor site	probably null
R5769:Plb1	UTSW	5	32317522	missense	probably benign	0.05
R6366:Plb1	UTSW	5	32314085	missense	possibly damaging	0.59
R6700:Plb1	UTSW	5	32333464	missense	probably damaging	0.99
R7162:Plb1	UTSW	5	32349663	missense	probably benign	0.30
R7379:Plb1	UTSW	5	32345639	missense	probably damaging	1.00
R7395:Plb1	UTSW	5	32353684	missense	probably benign	0.30
R7426:Plb1	UTSW	5	32321247	intron	probably null
R7643:Plb1	UTSW	5	32247557	nonsense	probably null
R7657:Plb1	UTSW	5	32329867	missense	probably damaging	0.98
R8040:Plb1	UTSW	5	32273069	missense	not run
X0018:Plb1	UTSW	5	32285883	missense	probably benign	0.01
X0019:Plb1	UTSW	5	32353697	missense	probably damaging	0.99
X0027:Plb1	UTSW	5	32270358	missense	probably benign
X0028:Plb1	UTSW	5	32302675	missense	probably damaging	1.00
Z1088:Plb1	UTSW	5	32310917	missense	probably benign
Z1088:Plb1	UTSW	5	32310847	missense	probably damaging	0.99
Z1177:Plb1	UTSW	5	32284897	missense	not run

Predicted Primers

PCR Primer
(F):5'- ACGAGATCTTTTGGCCCCTG -3'
(R):5'- AAGGACGCATTTCCCTCTC -3'

Sequencing Primer
(F):5'- TGCACAACCCCTCAGAAATGTTTTG -3'
(R):5'- CCCCCACTTCCAAGTCCATC -3'

Posted On

2016-11-08