Mutagenetix > Incidental Mutations

Incidental Mutation 'R5619:Tgfbr3'

439703

Institutional Source

Beutler Lab

Gene Symbol

Tgfbr3

Ensembl Gene

ENSMUSG00000029287

Gene Name

transforming growth factor, beta receptor III

Synonyms

betaglycan, TBRIII, 1110036H20Rik

MMRRC Submission

043278-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5619 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107106570-107289629 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 107140514 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 427 (I427N)

Ref Sequence

ENSEMBL: ENSMUSP00000031224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031224]

Predicted Effect

probably benign
Transcript: ENSMUST00000031224
AA Change: I427N

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031224
Gene: ENSMUSG00000029287
AA Change: I427N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
internal_repeat_1	64	193	2.48e-5	PROSPERO
internal_repeat_1	232	361	2.48e-5	PROSPERO
low complexity region	419	430	N/A	INTRINSIC
ZP	454	731	8.12e-65	SMART
transmembrane domain	786	808	N/A	INTRINSIC
low complexity region	835	849	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138469

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199780

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.7%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die as embryos. The very few individuals that survive are poorly fertile with abnormalities of the spleen, liver, heart, and skeletal system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4931423N10Rik	T	C	2: 23,257,005		probably null	Het
Adgre1	T	G	17: 57,420,437	L456V	probably benign	Het
Adgrv1	C	T	13: 81,472,500	G3943R	probably damaging	Het
Akap9	A	G	5: 3,954,760		probably benign	Het
Atp1a2	T	A	1: 172,279,381	I791F	probably damaging	Het
BC003965	G	A	17: 25,184,989	S101N	probably damaging	Het
BC004004	C	G	17: 29,282,729	P81A	probably damaging	Het
Brca2	C	A	5: 150,557,114	T2755K	probably damaging	Het
Cacna1c	T	C	6: 118,742,361	D215G	probably damaging	Het
Ccdc142	C	T	6: 83,103,622	S445F	probably benign	Het
Comt	T	C	16: 18,411,719	E80G	probably damaging	Het
Coq7	T	C	7: 118,527,486		probably benign	Het
Coro7	C	A	16: 4,676,935		probably null	Het
Cyp2c40	A	G	19: 39,803,784	S239P	probably damaging	Het
Dnah5	T	C	15: 28,302,435	S1613P	probably damaging	Het
Dync2h1	T	C	9: 7,118,885	I2193M	probably benign	Het
Eipr1	A	G	12: 28,867,079	Y382C	probably damaging	Het
Fastkd2	T	A	1: 63,739,310	H447Q	probably benign	Het
Galk2	A	T	2: 125,975,397	R369*	probably null	Het
Gli2	G	A	1: 118,836,755	A1222V	probably benign	Het
Golim4	T	A	3: 75,906,495	K141*	probably null	Het
Gtpbp3	G	T	8: 71,491,048		probably benign	Het
Gzmd	C	T	14: 56,129,767	A223T	probably benign	Het
Igf2r	T	C	17: 12,739,334	R151G	probably damaging	Het
Itga8	T	A	2: 12,265,328	R116W	probably damaging	Het
Klhdc1	T	G	12: 69,258,145		probably null	Het
Klhl25	T	C	7: 75,866,854	Y198H	probably benign	Het
Klhl29	A	T	12: 5,140,587	M136K	probably benign	Het
Lipf	A	T	19: 33,966,892	Y167F	possibly damaging	Het
Lpar1	T	C	4: 58,487,155	K39E	possibly damaging	Het
Mbtd1	T	A	11: 93,929,879		probably null	Het
Myo1a	T	A	10: 127,718,544	N794K	probably benign	Het
Nmrk1	T	C	19: 18,645,088	L177P	possibly damaging	Het
Noxa1	C	T	2: 25,085,976	E401K	probably damaging	Het
Olfr1276	A	T	2: 111,257,511	Y132F	probably damaging	Het
Olfr980	T	A	9: 40,006,743	M69L	probably benign	Het
Ostm1	T	A	10: 42,679,329	C116S	probably damaging	Het
Pcdhga7	T	C	18: 37,715,747	I269T	probably benign	Het
Pfkfb3	T	C	2: 11,484,659	K276R	probably benign	Het
Pfkp	A	T	13: 6,598,729		probably benign	Het
Pitpnm1	A	G	19: 4,103,270	D142G	probably damaging	Het
Pkp3	T	C	7: 141,088,506	L556P	probably damaging	Het
Plb1	C	A	5: 32,333,497	T1046N	probably damaging	Het
Plxnb2	T	C	15: 89,162,809	S770G	possibly damaging	Het
Polk	A	T	13: 96,483,556	I733N	probably damaging	Het
Prkg2	C	A	5: 98,988,297	C301F	probably damaging	Het
Rabgap1l	T	C	1: 160,238,572	T189A	probably benign	Het
Raph1	T	C	1: 60,490,255		probably benign	Het
Rbm22	T	A	18: 60,560,827	M1K	probably null	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rnf186	T	A	4: 138,967,404	I85N	probably benign	Het
Ryr2	C	A	13: 11,708,202	R2517L	probably damaging	Het
Sec63	T	A	10: 42,789,382	Y103N	probably damaging	Het
Serpinb3a	G	A	1: 107,047,108	P232S	probably damaging	Het
Slco6d1	C	A	1: 98,496,222	T533K	probably damaging	Het
Smarcad1	T	A	6: 65,111,881	D1000E	probably benign	Het
Spata46	A	T	1: 170,308,921	I14F	probably damaging	Het
Speer4b	T	C	5: 27,498,817	H106R	possibly damaging	Het
Spint4	T	C	2: 164,700,841	L118P	probably benign	Het
Sptbn5	A	G	2: 120,050,132		noncoding transcript	Het
Thbs2	C	A	17: 14,681,244	C491F	probably damaging	Het
Tmem232	T	A	17: 65,486,511	E64D	probably benign	Het
Tnpo3	A	T	6: 29,565,198	C585*	probably null	Het
Ttc13	A	T	8: 124,679,944		probably benign	Het
Tuba8	C	T	6: 121,225,895	A389V	probably damaging	Het
Usp25	A	G	16: 77,033,945	I30V	probably benign	Het
Vmn2r31	T	A	7: 7,384,530	K681*	probably null	Het
Vmn2r88	A	G	14: 51,413,910	E235G	probably damaging	Het
Vps29	T	A	5: 122,354,448		probably benign	Het
Wdr1	A	C	5: 38,529,536	V568G	possibly damaging	Het
Zfp64	T	G	2: 168,899,814	Q398P	probably damaging	Het
Zfp64	G	T	2: 168,899,815	Q398K	probably damaging	Het
Zfp839	T	C	12: 110,864,036	Y398H	probably damaging	Het

Other mutations in Tgfbr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Tgfbr3	APN	5	107142501	missense	probably benign	0.00
IGL01135:Tgfbr3	APN	5	107215028	missense	probably damaging	1.00
IGL01375:Tgfbr3	APN	5	107136971	missense	probably benign
IGL01457:Tgfbr3	APN	5	107149898	missense	probably damaging	1.00
IGL01599:Tgfbr3	APN	5	107118451	missense	probably damaging	0.98
IGL01646:Tgfbr3	APN	5	107121413	splice site	probably benign
IGL01945:Tgfbr3	APN	5	107121358	critical splice donor site	probably null
IGL03039:Tgfbr3	APN	5	107177799	splice site	probably benign
IGL03202:Tgfbr3	APN	5	107109764	splice site	probably benign
IGL03378:Tgfbr3	APN	5	107109702	missense	probably damaging	1.00
R0131:Tgfbr3	UTSW	5	107132816	missense	probably benign	0.00
R0452:Tgfbr3	UTSW	5	107140423	missense	probably benign	0.00
R0665:Tgfbr3	UTSW	5	107177850	missense	probably benign	0.11
R0667:Tgfbr3	UTSW	5	107177850	missense	probably benign	0.11
R0751:Tgfbr3	UTSW	5	107139883	missense	probably damaging	1.00
R1373:Tgfbr3	UTSW	5	107214943	missense	probably benign	0.01
R1777:Tgfbr3	UTSW	5	107136930	missense	probably benign	0.31
R1887:Tgfbr3	UTSW	5	107137008	missense	probably damaging	1.00
R3019:Tgfbr3	UTSW	5	107137546	missense	possibly damaging	0.70
R3552:Tgfbr3	UTSW	5	107139839	missense	probably damaging	0.99
R3617:Tgfbr3	UTSW	5	107140619	missense	possibly damaging	0.65
R3901:Tgfbr3	UTSW	5	107214887	splice site	probably benign
R4830:Tgfbr3	UTSW	5	107109719	missense	probably damaging	1.00
R4939:Tgfbr3	UTSW	5	107130469	missense	probably benign
R5020:Tgfbr3	UTSW	5	107214970	missense	probably damaging	1.00
R5044:Tgfbr3	UTSW	5	107136929	missense	possibly damaging	0.88
R5752:Tgfbr3	UTSW	5	107139807	missense	probably benign	0.01
R5768:Tgfbr3	UTSW	5	107149895	missense	probably benign
R5799:Tgfbr3	UTSW	5	107109608	utr 3 prime	probably benign
R5818:Tgfbr3	UTSW	5	107133003	missense	probably benign
R5846:Tgfbr3	UTSW	5	107140655	missense	possibly damaging	0.51
R5859:Tgfbr3	UTSW	5	107140515	missense	probably benign	0.00
R6049:Tgfbr3	UTSW	5	107118485	missense	probably damaging	0.99
R6378:Tgfbr3	UTSW	5	107177813	missense	probably benign	0.00
R6696:Tgfbr3	UTSW	5	107136930	missense	probably benign	0.02
R6823:Tgfbr3	UTSW	5	107149914	missense	probably damaging	1.00
R6994:Tgfbr3	UTSW	5	107133026	missense	probably damaging	1.00
R7454:Tgfbr3	UTSW	5	107215028	missense	probably damaging	1.00
R7773:Tgfbr3	UTSW	5	107140502	missense	probably benign	0.00
X0022:Tgfbr3	UTSW	5	107136926	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAAAGCTTCACGTCTTTC -3'
(R):5'- GTCACTCATGATGGCTTGCC -3'

Sequencing Primer
(F):5'- CCTTTAAGAGACTGCACTGACCTG -3'
(R):5'- CCTGTCTTTCCCAGAGGAGATGAG -3'

Posted On

2016-11-08