Incidental Mutation 'R5619:Vps29'
ID439704
Institutional Source Beutler Lab
Gene Symbol Vps29
Ensembl Gene ENSMUSG00000029462
Gene NameVPS29 retromer complex component
SynonymsPEP11, 2010015D08Rik
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5619 (G1)
Quality Score178
Status Validated
Chromosome5
Chromosomal Location122354369-122364984 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to A at 122354448 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049009] [ENSMUST00000111729] [ENSMUST00000117263] [ENSMUST00000117868] [ENSMUST00000118765] [ENSMUST00000118830] [ENSMUST00000144268] [ENSMUST00000145821] [ENSMUST00000154686] [ENSMUST00000155671]
Predicted Effect probably benign
Transcript: ENSMUST00000049009
SMART Domains Protein: ENSMUSP00000036177
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.8e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111729
SMART Domains Protein: ENSMUSP00000107358
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117263
SMART Domains Protein: ENSMUSP00000113868
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117868
SMART Domains Protein: ENSMUSP00000113345
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 143 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118765
SMART Domains Protein: ENSMUSP00000112579
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
PDB:1W24|A 1 65 7e-42 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000118830
SMART Domains Protein: ENSMUSP00000113525
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 6 162 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132785
Predicted Effect probably benign
Transcript: ENSMUST00000144268
SMART Domains Protein: ENSMUSP00000117334
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 64 6.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145821
SMART Domains Protein: ENSMUSP00000123593
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 11 124 1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149600
SMART Domains Protein: ENSMUSP00000120843
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 85 4.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154686
Predicted Effect probably benign
Transcript: ENSMUST00000155671
SMART Domains Protein: ENSMUSP00000121020
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 158 3.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200653
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes that, when functionally impaired, disrupt the efficient delivery of vacuolar hydrolases. The protein encoded by this gene is a component of a large multimeric complex, termed the retromer complex, which is involved in retrograde transport of proteins from endosomes to the trans-Golgi network. This VPS protein may be involved in the formation of the inner shell of the retromer coat for retrograde vesicles leaving the prevacuolar compartment. Alternative splice variants encoding different isoforms and representing non-protein coding transcripts have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Vps29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Vps29 APN 5 122362867 missense probably damaging 1.00
IGL02627:Vps29 APN 5 122362845 missense probably benign 0.00
IGL02716:Vps29 APN 5 122362066 missense probably benign 0.20
R4807:Vps29 UTSW 5 122362888 missense probably damaging 1.00
R7431:Vps29 UTSW 5 122354478 missense probably benign
R7866:Vps29 UTSW 5 122362117 missense possibly damaging 0.91
R7949:Vps29 UTSW 5 122362117 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACGAGCGATTTCTTGCAGCG -3'
(R):5'- TCTGATGCAGACTGGGTAAGC -3'

Sequencing Primer
(F):5'- ATTTCTTGCAGCGCCGGG -3'
(R):5'- ACGACATCGCTCAATGGG -3'
Posted On2016-11-08