Incidental Mutation 'R5619:Ttc13'
ID439716
Institutional Source Beutler Lab
Gene Symbol Ttc13
Ensembl Gene ENSMUSG00000037300
Gene Nametetratricopeptide repeat domain 13
SynonymsMGC:28881
MMRRC Submission 043278-MU
Accession Numbers

Genbank: NM_145607; MGI: 28881

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location124671332-124721983 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 124679944 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]
Predicted Effect probably benign
Transcript: ENSMUST00000041614
SMART Domains Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:TPR_11 153 204 3e-8 PFAM
Pfam:TPR_19 154 213 5.1e-8 PFAM
Pfam:TPR_1 173 206 6.1e-10 PFAM
Pfam:TPR_2 173 206 1.2e-7 PFAM
Pfam:TPR_8 173 206 5.2e-8 PFAM
Pfam:TPR_16 177 241 6.5e-11 PFAM
Pfam:TPR_9 179 249 3.5e-6 PFAM
Pfam:TPR_11 204 272 2.2e-8 PFAM
Pfam:TPR_1 207 240 3.3e-5 PFAM
Pfam:TPR_2 207 240 1.9e-5 PFAM
Blast:UTG 692 755 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117624
SMART Domains Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 161 2e-13 BLAST
TPR 162 194 1.08e1 SMART
TPR 195 228 2.24e-7 SMART
TPR 229 262 3.67e-3 SMART
Blast:UTG 714 777 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118134
SMART Domains Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 156 4e-10 BLAST
TPR 181 214 5.56e-3 SMART
TPR 215 248 1.17e-1 SMART
TPR 249 282 2.24e-7 SMART
TPR 283 316 3.67e-3 SMART
Blast:UTG 768 831 1e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140350
Predicted Effect probably benign
Transcript: ENSMUST00000214828
Predicted Effect probably benign
Transcript: ENSMUST00000231984
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhdc1 T G 12: 69,258,145 probably null Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Ttc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc13 APN 8 124688847 splice site probably benign
IGL01086:Ttc13 APN 8 124675346 missense probably damaging 0.98
IGL01411:Ttc13 APN 8 124683285 missense probably damaging 1.00
IGL01511:Ttc13 APN 8 124676371 missense probably damaging 1.00
IGL01610:Ttc13 APN 8 124676344 missense probably damaging 1.00
IGL01626:Ttc13 APN 8 124673738 splice site probably benign
IGL01967:Ttc13 APN 8 124712647 missense probably damaging 0.99
IGL01995:Ttc13 APN 8 124688882 missense probably damaging 1.00
IGL02456:Ttc13 APN 8 124690361 critical splice acceptor site probably null
IGL02816:Ttc13 APN 8 124712676 missense possibly damaging 0.89
3-1:Ttc13 UTSW 8 124679009 missense possibly damaging 0.81
LCD18:Ttc13 UTSW 8 124675866 intron probably benign
R0126:Ttc13 UTSW 8 124683291 missense probably damaging 0.99
R0391:Ttc13 UTSW 8 124674401 missense probably damaging 1.00
R0602:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0629:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0638:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0714:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R1981:Ttc13 UTSW 8 124714187 critical splice donor site probably null
R2051:Ttc13 UTSW 8 124672211 splice site probably null
R2324:Ttc13 UTSW 8 124679057 missense probably damaging 1.00
R2404:Ttc13 UTSW 8 124678997 splice site probably benign
R2571:Ttc13 UTSW 8 124683799 missense probably damaging 1.00
R3110:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R3112:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R4560:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4562:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4563:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4565:Ttc13 UTSW 8 124682087 missense probably damaging 1.00
R4855:Ttc13 UTSW 8 124674435 missense probably damaging 1.00
R4998:Ttc13 UTSW 8 124680056 missense probably damaging 1.00
R5137:Ttc13 UTSW 8 124694935 nonsense probably null
R5397:Ttc13 UTSW 8 124675263 missense possibly damaging 0.94
R5966:Ttc13 UTSW 8 124682220 intron probably benign
R6092:Ttc13 UTSW 8 124679033 missense probably benign 0.36
R6321:Ttc13 UTSW 8 124683191 missense probably damaging 1.00
R6439:Ttc13 UTSW 8 124673482 missense probably benign 0.02
R6737:Ttc13 UTSW 8 124682161 critical splice acceptor site probably null
R6804:Ttc13 UTSW 8 124699687 missense probably damaging 1.00
R6967:Ttc13 UTSW 8 124688618 missense probably benign 0.17
R7542:Ttc13 UTSW 8 124675103 intron probably null
R7905:Ttc13 UTSW 8 124688596 missense probably benign 0.09
R7988:Ttc13 UTSW 8 124688596 missense probably benign 0.09
X0027:Ttc13 UTSW 8 124673589 missense probably benign
Z1176:Ttc13 UTSW 8 124694842 missense not run
Predicted Primers PCR Primer
(F):5'- CAAGGCCAACACTGTGAAGC -3'
(R):5'- TGGACACTTTCTGCCAGGAC -3'

Sequencing Primer
(F):5'- ACACTGTGAAGCCATTACTCTGG -3'
(R):5'- GACACTTTCTGCCAGGACAGATTC -3'
Posted On2016-11-08