Incidental Mutation 'R5619:Klhdc1'
ID439727
Institutional Source Beutler Lab
Gene Symbol Klhdc1
Ensembl Gene ENSMUSG00000051890
Gene Namekelch domain containing 1
Synonyms
MMRRC Submission 043278-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5619 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69241176-69284632 bp(+) (GRCm38)
Type of Mutationintron (39 bp from exon)
DNA Base Change (assembly) T to G at 69258145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063445] [ENSMUST00000173419]
Predicted Effect probably null
Transcript: ENSMUST00000063445
SMART Domains Protein: ENSMUSP00000068046
Gene: ENSMUSG00000051890

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.4e-11 PFAM
Pfam:Kelch_4 67 122 4.4e-7 PFAM
Pfam:Kelch_6 67 124 1.7e-7 PFAM
Pfam:Kelch_3 79 125 1.8e-8 PFAM
Pfam:Kelch_3 170 205 2.5e-7 PFAM
Pfam:Kelch_2 196 235 2.8e-8 PFAM
Pfam:Kelch_1 196 236 1.4e-6 PFAM
Pfam:Kelch_4 196 245 5.5e-7 PFAM
Pfam:Kelch_3 206 256 3.9e-8 PFAM
Pfam:Kelch_4 247 295 5.3e-10 PFAM
Pfam:Kelch_3 258 307 1.7e-7 PFAM
low complexity region 364 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173419
SMART Domains Protein: ENSMUSP00000134180
Gene: ENSMUSG00000051890

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.7e-11 PFAM
Pfam:Kelch_4 67 123 1.7e-8 PFAM
Pfam:Kelch_6 67 124 5.6e-8 PFAM
Pfam:Kelch_1 68 116 3.2e-6 PFAM
Pfam:Kelch_3 78 126 3.1e-9 PFAM
Pfam:Kelch_3 165 205 2.8e-8 PFAM
Pfam:Kelch_5 193 237 2.7e-6 PFAM
Pfam:Kelch_2 196 235 1.8e-8 PFAM
Pfam:Kelch_6 196 237 2.6e-8 PFAM
Pfam:Kelch_4 196 245 2e-7 PFAM
Pfam:Kelch_3 206 256 2.1e-7 PFAM
Pfam:Kelch_5 245 285 2.4e-6 PFAM
Pfam:Kelch_4 247 299 3.5e-11 PFAM
Pfam:Kelch_6 247 299 3.2e-8 PFAM
Pfam:Kelch_3 258 301 1.2e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931423N10Rik T C 2: 23,257,005 probably null Het
Adgre1 T G 17: 57,420,437 L456V probably benign Het
Adgrv1 C T 13: 81,472,500 G3943R probably damaging Het
Akap9 A G 5: 3,954,760 probably benign Het
Atp1a2 T A 1: 172,279,381 I791F probably damaging Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
BC004004 C G 17: 29,282,729 P81A probably damaging Het
Brca2 C A 5: 150,557,114 T2755K probably damaging Het
Cacna1c T C 6: 118,742,361 D215G probably damaging Het
Ccdc142 C T 6: 83,103,622 S445F probably benign Het
Comt T C 16: 18,411,719 E80G probably damaging Het
Coq7 T C 7: 118,527,486 probably benign Het
Coro7 C A 16: 4,676,935 probably null Het
Cyp2c40 A G 19: 39,803,784 S239P probably damaging Het
Dnah5 T C 15: 28,302,435 S1613P probably damaging Het
Dync2h1 T C 9: 7,118,885 I2193M probably benign Het
Eipr1 A G 12: 28,867,079 Y382C probably damaging Het
Fastkd2 T A 1: 63,739,310 H447Q probably benign Het
Galk2 A T 2: 125,975,397 R369* probably null Het
Gli2 G A 1: 118,836,755 A1222V probably benign Het
Golim4 T A 3: 75,906,495 K141* probably null Het
Gtpbp3 G T 8: 71,491,048 probably benign Het
Gzmd C T 14: 56,129,767 A223T probably benign Het
Igf2r T C 17: 12,739,334 R151G probably damaging Het
Itga8 T A 2: 12,265,328 R116W probably damaging Het
Klhl25 T C 7: 75,866,854 Y198H probably benign Het
Klhl29 A T 12: 5,140,587 M136K probably benign Het
Lipf A T 19: 33,966,892 Y167F possibly damaging Het
Lpar1 T C 4: 58,487,155 K39E possibly damaging Het
Mbtd1 T A 11: 93,929,879 probably null Het
Myo1a T A 10: 127,718,544 N794K probably benign Het
Nmrk1 T C 19: 18,645,088 L177P possibly damaging Het
Noxa1 C T 2: 25,085,976 E401K probably damaging Het
Olfr1276 A T 2: 111,257,511 Y132F probably damaging Het
Olfr980 T A 9: 40,006,743 M69L probably benign Het
Ostm1 T A 10: 42,679,329 C116S probably damaging Het
Pcdhga7 T C 18: 37,715,747 I269T probably benign Het
Pfkfb3 T C 2: 11,484,659 K276R probably benign Het
Pfkp A T 13: 6,598,729 probably benign Het
Pitpnm1 A G 19: 4,103,270 D142G probably damaging Het
Pkp3 T C 7: 141,088,506 L556P probably damaging Het
Plb1 C A 5: 32,333,497 T1046N probably damaging Het
Plxnb2 T C 15: 89,162,809 S770G possibly damaging Het
Polk A T 13: 96,483,556 I733N probably damaging Het
Prkg2 C A 5: 98,988,297 C301F probably damaging Het
Rabgap1l T C 1: 160,238,572 T189A probably benign Het
Raph1 T C 1: 60,490,255 probably benign Het
Rbm22 T A 18: 60,560,827 M1K probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf186 T A 4: 138,967,404 I85N probably benign Het
Ryr2 C A 13: 11,708,202 R2517L probably damaging Het
Sec63 T A 10: 42,789,382 Y103N probably damaging Het
Serpinb3a G A 1: 107,047,108 P232S probably damaging Het
Slco6d1 C A 1: 98,496,222 T533K probably damaging Het
Smarcad1 T A 6: 65,111,881 D1000E probably benign Het
Spata46 A T 1: 170,308,921 I14F probably damaging Het
Speer4b T C 5: 27,498,817 H106R possibly damaging Het
Spint4 T C 2: 164,700,841 L118P probably benign Het
Sptbn5 A G 2: 120,050,132 noncoding transcript Het
Tgfbr3 A T 5: 107,140,514 I427N probably benign Het
Thbs2 C A 17: 14,681,244 C491F probably damaging Het
Tmem232 T A 17: 65,486,511 E64D probably benign Het
Tnpo3 A T 6: 29,565,198 C585* probably null Het
Ttc13 A T 8: 124,679,944 probably benign Het
Tuba8 C T 6: 121,225,895 A389V probably damaging Het
Usp25 A G 16: 77,033,945 I30V probably benign Het
Vmn2r31 T A 7: 7,384,530 K681* probably null Het
Vmn2r88 A G 14: 51,413,910 E235G probably damaging Het
Vps29 T A 5: 122,354,448 probably benign Het
Wdr1 A C 5: 38,529,536 V568G possibly damaging Het
Zfp64 T G 2: 168,899,814 Q398P probably damaging Het
Zfp64 G T 2: 168,899,815 Q398K probably damaging Het
Zfp839 T C 12: 110,864,036 Y398H probably damaging Het
Other mutations in Klhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Klhdc1 APN 12 69242008 missense possibly damaging 0.92
IGL01432:Klhdc1 APN 12 69251977 missense probably damaging 0.97
IGL02086:Klhdc1 APN 12 69283184 missense probably benign 0.18
IGL02212:Klhdc1 APN 12 69250766 missense probably damaging 1.00
IGL02548:Klhdc1 APN 12 69253718 missense probably benign 0.00
IGL02861:Klhdc1 APN 12 69251451 missense possibly damaging 0.85
R0446:Klhdc1 UTSW 12 69283308 missense probably benign
R0656:Klhdc1 UTSW 12 69258030 missense probably benign
R1528:Klhdc1 UTSW 12 69263198 missense probably benign 0.02
R3001:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R3002:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R4428:Klhdc1 UTSW 12 69268226 intron probably benign
R4738:Klhdc1 UTSW 12 69283133 missense probably benign 0.07
R5009:Klhdc1 UTSW 12 69251938 missense possibly damaging 0.89
R5366:Klhdc1 UTSW 12 69283150 missense probably damaging 0.99
R5662:Klhdc1 UTSW 12 69283165 missense probably benign 0.07
R5911:Klhdc1 UTSW 12 69256251 missense possibly damaging 0.80
R5995:Klhdc1 UTSW 12 69250774 missense probably damaging 1.00
R6708:Klhdc1 UTSW 12 69259530 missense possibly damaging 0.75
R6992:Klhdc1 UTSW 12 69253757 missense probably damaging 1.00
R7224:Klhdc1 UTSW 12 69263149 missense probably damaging 1.00
R7597:Klhdc1 UTSW 12 69269868 missense probably damaging 1.00
R7833:Klhdc1 UTSW 12 69283168 missense probably benign 0.12
R7916:Klhdc1 UTSW 12 69283168 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TACGGCCGTTTCAAGTCTGTC -3'
(R):5'- TCAACATGGAACTTCCCGG -3'

Sequencing Primer
(F):5'- GGCCGTTTCAAGTCTGTCTTCTG -3'
(R):5'- ATGGAACTTCCCGGGGTCAG -3'
Posted On2016-11-08