Incidental Mutation 'R5620:Myo3b'
ID439764
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 043160-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5620 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70238910 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 498 (R498G)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: R526G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: R526G

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: R498G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: R498G

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,338,391 S511A probably benign Het
Abca3 C T 17: 24,396,470 T845I probably benign Het
Acaa2 G A 18: 74,805,874 A377T possibly damaging Het
Adcy4 C A 14: 55,772,367 E743* probably null Het
Ahnak T A 19: 9,013,094 L3914* probably null Het
Akap1 G T 11: 88,845,517 N106K possibly damaging Het
Arhgap8 A G 15: 84,756,369 S140G probably benign Het
Arid2 C T 15: 96,372,506 T1500I probably benign Het
Atp6v0a2 T A 5: 124,645,969 Y252* probably null Het
BC055324 C A 1: 163,962,044 G641* probably null Het
C4bp A G 1: 130,653,353 S140P probably damaging Het
Cald1 A G 6: 34,762,112 I384M probably damaging Het
Cdk12 A G 11: 98,210,983 I556V unknown Het
Chmp2a T C 7: 13,032,310 S174G probably benign Het
Clybl T A 14: 122,311,343 N52K probably damaging Het
Cyp4a29 C A 4: 115,250,891 S303R probably benign Het
Dab2 T A 15: 6,418,315 D59E probably damaging Het
Dag1 C A 9: 108,209,015 R309L probably damaging Het
Dync1i2 T A 2: 71,258,139 M505K probably benign Het
Eif2b1 A T 5: 124,579,012 M1K probably null Het
Epc1 A G 18: 6,448,917 S577P probably benign Het
Eps8l1 T A 7: 4,460,946 I23N possibly damaging Het
Etl4 A G 2: 20,530,226 E164G probably damaging Het
Gadl1 A T 9: 115,937,162 M1L probably benign Het
Gda T C 19: 21,397,544 D336G probably damaging Het
Grm2 A T 9: 106,650,446 V413D probably damaging Het
Hnrnpll G T 17: 80,038,622 N403K probably damaging Het
Ifit1 T A 19: 34,647,838 F125I probably damaging Het
Igkv5-43 C T 6: 69,823,908 V2I probably benign Het
Kat5 A C 19: 5,609,479 Y44* probably null Het
Klc2 A G 19: 5,112,856 V205A probably damaging Het
Klrb1c T A 6: 128,784,743 T133S possibly damaging Het
Krt20 A G 11: 99,435,457 L157P probably damaging Het
Krt26 G T 11: 99,337,771 T45N possibly damaging Het
Lama2 C T 10: 26,990,880 D2873N probably damaging Het
Lig1 T A 7: 13,286,606 C114S possibly damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Maml2 A T 9: 13,697,320 R21S probably damaging Het
Mrpl35 C T 6: 71,817,736 V83I probably benign Het
Nup153 C A 13: 46,684,006 E1247* probably null Het
Olfr330 A T 11: 58,529,731 M85K probably damaging Het
Pcdhac2 A G 18: 37,144,204 N79S probably benign Het
Pcgf6 C T 19: 47,047,967 G221D probably damaging Het
Phf11b C T 14: 59,321,504 D260N probably benign Het
Pla2g5 T C 4: 138,804,610 M28V possibly damaging Het
Prpf8 T C 11: 75,505,101 S1934P possibly damaging Het
Prrc2c T C 1: 162,673,529 D1235G probably damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rassf8 C T 6: 145,820,181 probably benign Het
Rgs20 T A 1: 4,912,443 E167D probably damaging Het
Rmnd1 G T 10: 4,422,159 A180E probably damaging Het
Rnf103 A G 6: 71,510,008 D541G probably benign Het
Rpl9 G T 5: 65,389,125 Q140K probably benign Het
Sfmbt1 T G 14: 30,784,191 probably null Het
Shank1 C A 7: 44,312,736 D10E unknown Het
Srrm4 G T 5: 116,449,613 probably benign Het
Sucla2 T A 14: 73,595,396 V447E probably damaging Het
Tbc1d1 A G 5: 64,173,712 D78G probably benign Het
Tcp1 T A 17: 12,919,337 probably null Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Thsd7b G A 1: 130,162,936 probably null Het
Tmem63a A G 1: 180,970,246 M621V probably benign Het
Tnxb A T 17: 34,717,530 K2756* probably null Het
Trpm8 G A 1: 88,359,651 probably null Het
Txndc16 C A 14: 45,135,878 V764F possibly damaging Het
Ush2a A T 1: 188,759,823 D3103V possibly damaging Het
Usp22 A T 11: 61,158,380 I381N probably damaging Het
Zfp462 T A 4: 55,013,464 M1810K probably benign Het
Zfp64 T A 2: 168,899,968 M347L possibly damaging Het
Zfp69 T C 4: 120,930,522 D532G probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAGGGCAGCATCATTGGAG -3'
(R):5'- AAATCAGCTACCACTGCTCCTTTG -3'

Sequencing Primer
(F):5'- CGAAGGCTTCTCTTGAATGC -3'
(R):5'- TAGAGGTTCACCTACGCT -3'
Posted On2016-11-08