Mutagenetix > Incidental Mutation

Incidental Mutation 'R5620:Atp6v0a2'

439778

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

043160-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R5620 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 124645969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 252 (Y252*)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000037865
AA Change: Y252*

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: Y252*

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197931

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	A	C	15: 102,338,391	S511A	probably benign	Het
Abca3	C	T	17: 24,396,470	T845I	probably benign	Het
Acaa2	G	A	18: 74,805,874	A377T	possibly damaging	Het
Adcy4	C	A	14: 55,772,367	E743*	probably null	Het
Ahnak	T	A	19: 9,013,094	L3914*	probably null	Het
Akap1	G	T	11: 88,845,517	N106K	possibly damaging	Het
Arhgap8	A	G	15: 84,756,369	S140G	probably benign	Het
Arid2	C	T	15: 96,372,506	T1500I	probably benign	Het
BC055324	C	A	1: 163,962,044	G641*	probably null	Het
C4bp	A	G	1: 130,653,353	S140P	probably damaging	Het
Cald1	A	G	6: 34,762,112	I384M	probably damaging	Het
Cdk12	A	G	11: 98,210,983	I556V	unknown	Het
Chmp2a	T	C	7: 13,032,310	S174G	probably benign	Het
Clybl	T	A	14: 122,311,343	N52K	probably damaging	Het
Cyp4a29	C	A	4: 115,250,891	S303R	probably benign	Het
Dab2	T	A	15: 6,418,315	D59E	probably damaging	Het
Dag1	C	A	9: 108,209,015	R309L	probably damaging	Het
Dync1i2	T	A	2: 71,258,139	M505K	probably benign	Het
Eif2b1	A	T	5: 124,579,012	M1K	probably null	Het
Epc1	A	G	18: 6,448,917	S577P	probably benign	Het
Eps8l1	T	A	7: 4,460,946	I23N	possibly damaging	Het
Etl4	A	G	2: 20,530,226	E164G	probably damaging	Het
Gadl1	A	T	9: 115,937,162	M1L	probably benign	Het
Gda	T	C	19: 21,397,544	D336G	probably damaging	Het
Grm2	A	T	9: 106,650,446	V413D	probably damaging	Het
Hnrnpll	G	T	17: 80,038,622	N403K	probably damaging	Het
Ifit1	T	A	19: 34,647,838	F125I	probably damaging	Het
Igkv5-43	C	T	6: 69,823,908	V2I	probably benign	Het
Kat5	A	C	19: 5,609,479	Y44*	probably null	Het
Klc2	A	G	19: 5,112,856	V205A	probably damaging	Het
Klrb1c	T	A	6: 128,784,743	T133S	possibly damaging	Het
Krt20	A	G	11: 99,435,457	L157P	probably damaging	Het
Krt26	G	T	11: 99,337,771	T45N	possibly damaging	Het
Lama2	C	T	10: 26,990,880	D2873N	probably damaging	Het
Lig1	T	A	7: 13,286,606	C114S	possibly damaging	Het
Lonp1	G	C	17: 56,620,263	A330G	probably benign	Het
Maml2	A	T	9: 13,697,320	R21S	probably damaging	Het
Mrpl35	C	T	6: 71,817,736	V83I	probably benign	Het
Myo3b	A	G	2: 70,238,910	R498G	probably benign	Het
Nup153	C	A	13: 46,684,006	E1247*	probably null	Het
Olfr330	A	T	11: 58,529,731	M85K	probably damaging	Het
Pcdhac2	A	G	18: 37,144,204	N79S	probably benign	Het
Pcgf6	C	T	19: 47,047,967	G221D	probably damaging	Het
Phf11b	C	T	14: 59,321,504	D260N	probably benign	Het
Pla2g5	T	C	4: 138,804,610	M28V	possibly damaging	Het
Prpf8	T	C	11: 75,505,101	S1934P	possibly damaging	Het
Prrc2c	T	C	1: 162,673,529	D1235G	probably damaging	Het
Rasgrp2	T	C	19: 6,405,001	S254P	probably damaging	Het
Rassf8	C	T	6: 145,820,181		probably benign	Het
Rgs20	T	A	1: 4,912,443	E167D	probably damaging	Het
Rmnd1	G	T	10: 4,422,159	A180E	probably damaging	Het
Rnf103	A	G	6: 71,510,008	D541G	probably benign	Het
Rpl9	G	T	5: 65,389,125	Q140K	probably benign	Het
Sfmbt1	T	G	14: 30,784,191		probably null	Het
Shank1	C	A	7: 44,312,736	D10E	unknown	Het
Srrm4	G	T	5: 116,449,613		probably benign	Het
Sucla2	T	A	14: 73,595,396	V447E	probably damaging	Het
Tbc1d1	A	G	5: 64,173,712	D78G	probably benign	Het
Tcp1	T	A	17: 12,919,337		probably null	Het
Tctn3	C	A	19: 40,608,917	E230*	probably null	Het
Thsd7b	G	A	1: 130,162,936		probably null	Het
Tmem63a	A	G	1: 180,970,246	M621V	probably benign	Het
Tnxb	A	T	17: 34,717,530	K2756*	probably null	Het
Trpm8	G	A	1: 88,359,651		probably null	Het
Txndc16	C	A	14: 45,135,878	V764F	possibly damaging	Het
Ush2a	A	T	1: 188,759,823	D3103V	possibly damaging	Het
Usp22	A	T	11: 61,158,380	I381N	probably damaging	Het
Zfp462	T	A	4: 55,013,464	M1810K	probably benign	Het
Zfp64	T	A	2: 168,899,968	M347L	possibly damaging	Het
Zfp69	T	C	4: 120,930,522	D532G	probably damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGTTGCATGCAAGGCCTTC -3'
(R):5'- GAGAGACACAAAGGGCTTTTC -3'

Sequencing Primer
(F):5'- TGCAAGGCCTTCCCCAAG -3'
(R):5'- CTGGGCTTGTAACTGCAAAAC -3'

Posted On

2016-11-08