Incidental Mutation 'R5620:Lig1'
ID439786
Institutional Source Beutler Lab
Gene Symbol Lig1
Ensembl Gene ENSMUSG00000056394
Gene Nameligase I, DNA, ATP-dependent
SynonymsLigI, mLigI
MMRRC Submission 043160-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5620 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13277283-13311433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13286606 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 114 (C114S)
Ref Sequence ENSEMBL: ENSMUSP00000138907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000123025] [ENSMUST00000146998] [ENSMUST00000165964] [ENSMUST00000177588] [ENSMUST00000185145]
Predicted Effect probably benign
Transcript: ENSMUST00000098814
AA Change: C114S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: C114S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123025
AA Change: C113S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114872
Gene: ENSMUSG00000056394
AA Change: C113S

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
low complexity region 159 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123846
SMART Domains Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146998
AA Change: C114S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121102
Gene: ENSMUSG00000056394
AA Change: C114S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
low complexity region 160 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147735
SMART Domains Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148471
SMART Domains Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156525
SMART Domains Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165964
AA Change: C114S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: C114S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 302 478 1.7e-40 PFAM
Pfam:DNA_ligase_A_M 556 760 1.1e-69 PFAM
Pfam:DNA_ligase_A_C 785 896 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177588
AA Change: C114S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: C114S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185145
AA Change: C114S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138907
Gene: ENSMUSG00000056394
AA Change: C114S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
PDB:1X9N|A 247 313 3e-24 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,338,391 S511A probably benign Het
Abca3 C T 17: 24,396,470 T845I probably benign Het
Acaa2 G A 18: 74,805,874 A377T possibly damaging Het
Adcy4 C A 14: 55,772,367 E743* probably null Het
Ahnak T A 19: 9,013,094 L3914* probably null Het
Akap1 G T 11: 88,845,517 N106K possibly damaging Het
Arhgap8 A G 15: 84,756,369 S140G probably benign Het
Arid2 C T 15: 96,372,506 T1500I probably benign Het
Atp6v0a2 T A 5: 124,645,969 Y252* probably null Het
BC055324 C A 1: 163,962,044 G641* probably null Het
C4bp A G 1: 130,653,353 S140P probably damaging Het
Cald1 A G 6: 34,762,112 I384M probably damaging Het
Cdk12 A G 11: 98,210,983 I556V unknown Het
Chmp2a T C 7: 13,032,310 S174G probably benign Het
Clybl T A 14: 122,311,343 N52K probably damaging Het
Cyp4a29 C A 4: 115,250,891 S303R probably benign Het
Dab2 T A 15: 6,418,315 D59E probably damaging Het
Dag1 C A 9: 108,209,015 R309L probably damaging Het
Dync1i2 T A 2: 71,258,139 M505K probably benign Het
Eif2b1 A T 5: 124,579,012 M1K probably null Het
Epc1 A G 18: 6,448,917 S577P probably benign Het
Eps8l1 T A 7: 4,460,946 I23N possibly damaging Het
Etl4 A G 2: 20,530,226 E164G probably damaging Het
Gadl1 A T 9: 115,937,162 M1L probably benign Het
Gda T C 19: 21,397,544 D336G probably damaging Het
Grm2 A T 9: 106,650,446 V413D probably damaging Het
Hnrnpll G T 17: 80,038,622 N403K probably damaging Het
Ifit1 T A 19: 34,647,838 F125I probably damaging Het
Igkv5-43 C T 6: 69,823,908 V2I probably benign Het
Kat5 A C 19: 5,609,479 Y44* probably null Het
Klc2 A G 19: 5,112,856 V205A probably damaging Het
Klrb1c T A 6: 128,784,743 T133S possibly damaging Het
Krt20 A G 11: 99,435,457 L157P probably damaging Het
Krt26 G T 11: 99,337,771 T45N possibly damaging Het
Lama2 C T 10: 26,990,880 D2873N probably damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Maml2 A T 9: 13,697,320 R21S probably damaging Het
Mrpl35 C T 6: 71,817,736 V83I probably benign Het
Myo3b A G 2: 70,238,910 R498G probably benign Het
Nup153 C A 13: 46,684,006 E1247* probably null Het
Olfr330 A T 11: 58,529,731 M85K probably damaging Het
Pcdhac2 A G 18: 37,144,204 N79S probably benign Het
Pcgf6 C T 19: 47,047,967 G221D probably damaging Het
Phf11b C T 14: 59,321,504 D260N probably benign Het
Pla2g5 T C 4: 138,804,610 M28V possibly damaging Het
Prpf8 T C 11: 75,505,101 S1934P possibly damaging Het
Prrc2c T C 1: 162,673,529 D1235G probably damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rassf8 C T 6: 145,820,181 probably benign Het
Rgs20 T A 1: 4,912,443 E167D probably damaging Het
Rmnd1 G T 10: 4,422,159 A180E probably damaging Het
Rnf103 A G 6: 71,510,008 D541G probably benign Het
Rpl9 G T 5: 65,389,125 Q140K probably benign Het
Sfmbt1 T G 14: 30,784,191 probably null Het
Shank1 C A 7: 44,312,736 D10E unknown Het
Srrm4 G T 5: 116,449,613 probably benign Het
Sucla2 T A 14: 73,595,396 V447E probably damaging Het
Tbc1d1 A G 5: 64,173,712 D78G probably benign Het
Tcp1 T A 17: 12,919,337 probably null Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Thsd7b G A 1: 130,162,936 probably null Het
Tmem63a A G 1: 180,970,246 M621V probably benign Het
Tnxb A T 17: 34,717,530 K2756* probably null Het
Trpm8 G A 1: 88,359,651 probably null Het
Txndc16 C A 14: 45,135,878 V764F possibly damaging Het
Ush2a A T 1: 188,759,823 D3103V possibly damaging Het
Usp22 A T 11: 61,158,380 I381N probably damaging Het
Zfp462 T A 4: 55,013,464 M1810K probably benign Het
Zfp64 T A 2: 168,899,968 M347L possibly damaging Het
Zfp69 T C 4: 120,930,522 D532G probably damaging Het
Other mutations in Lig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Lig1 APN 7 13301452 nonsense probably null
IGL00499:Lig1 APN 7 13298830 critical splice donor site probably null
IGL01465:Lig1 APN 7 13296391 missense probably benign 0.19
IGL01804:Lig1 APN 7 13309206 missense probably benign 0.43
IGL02068:Lig1 APN 7 13292451 splice site probably benign
IGL02955:Lig1 APN 7 13296347 missense probably damaging 0.99
IGL03188:Lig1 APN 7 13311107 splice site probably benign
IGL03327:Lig1 APN 7 13303855 missense probably damaging 1.00
IGL03411:Lig1 APN 7 13296768 missense probably damaging 1.00
PIT4142001:Lig1 UTSW 7 13305924 frame shift probably null
R0085:Lig1 UTSW 7 13307570 missense possibly damaging 0.66
R0348:Lig1 UTSW 7 13309197 missense probably damaging 1.00
R0362:Lig1 UTSW 7 13296804 unclassified probably benign
R0787:Lig1 UTSW 7 13299069 missense probably benign 0.41
R1170:Lig1 UTSW 7 13292153 missense probably benign 0.00
R1371:Lig1 UTSW 7 13288685 missense probably damaging 1.00
R1610:Lig1 UTSW 7 13285340 missense probably damaging 1.00
R1809:Lig1 UTSW 7 13300355 splice site probably benign
R1986:Lig1 UTSW 7 13309142 nonsense probably null
R2106:Lig1 UTSW 7 13305938 missense probably damaging 1.00
R2343:Lig1 UTSW 7 13292195 splice site probably null
R2380:Lig1 UTSW 7 13303796 splice site probably benign
R3545:Lig1 UTSW 7 13292163 missense possibly damaging 0.82
R4669:Lig1 UTSW 7 13311028 missense probably damaging 1.00
R4928:Lig1 UTSW 7 13298738 missense probably damaging 1.00
R5167:Lig1 UTSW 7 13311058 missense probably damaging 0.97
R5249:Lig1 UTSW 7 13308507 missense possibly damaging 0.60
R5351:Lig1 UTSW 7 13300949 missense probably damaging 1.00
R5373:Lig1 UTSW 7 13305923 frame shift probably null
R5607:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5608:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5799:Lig1 UTSW 7 13296258 missense possibly damaging 0.67
R6057:Lig1 UTSW 7 13288672 missense probably damaging 0.99
R6897:Lig1 UTSW 7 13305914 missense probably damaging 1.00
R7202:Lig1 UTSW 7 13291249 missense probably benign 0.00
R7454:Lig1 UTSW 7 13288721 missense probably damaging 0.99
R7548:Lig1 UTSW 7 13301418 missense possibly damaging 0.79
R7596:Lig1 UTSW 7 13305998 missense probably damaging 1.00
R7597:Lig1 UTSW 7 13296344 missense probably benign
R7688:Lig1 UTSW 7 13289463 missense probably benign
R7733:Lig1 UTSW 7 13296231 missense possibly damaging 0.87
R8104:Lig1 UTSW 7 13286565 missense possibly damaging 0.46
X0020:Lig1 UTSW 7 13296774 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGTGGATCTAATGATACCTAGGTG -3'
(R):5'- GAGACAGTTAACCATGCTCACC -3'

Sequencing Primer
(F):5'- TACCTAGGTGAGAGAAGGTGGCC -3'
(R):5'- CACCACAGTTCTACCATTGGAAGG -3'
Posted On2016-11-08