Incidental Mutation 'R0496:St6gal2'
ID43979
Institutional Source Beutler Lab
Gene Symbol St6gal2
Ensembl Gene ENSMUSG00000024172
Gene Namebeta galactoside alpha 2,6 sialyltransferase 2
SynonymsST6Gal II, C230064G14Rik
MMRRC Submission 038692-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0496 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55445382-55514581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55482014 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 16 (I16M)
Ref Sequence ENSEMBL: ENSMUSP00000120762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025000] [ENSMUST00000086878] [ENSMUST00000133899]
Predicted Effect probably benign
Transcript: ENSMUST00000025000
AA Change: I16M

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025000
Gene: ENSMUSG00000024172
AA Change: I16M

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 251 257 N/A INTRINSIC
Pfam:Glyco_transf_29 272 501 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086878
AA Change: I16M

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084091
Gene: ENSMUSG00000024172
AA Change: I16M

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 234 438 9.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133899
AA Change: I16M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120762
Gene: ENSMUSG00000024172
AA Change: I16M

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 207 316 5.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153220
Meta Mutation Damage Score 0.1744 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sialyltransferase. The encoded type II transmembrane protein catalyzes the transfer of sialic acid from CMP to an oligosaccharide substrate. Polymorphisms at this locus may be associated with variations in risperidone response in schizophrenic patients. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,244 K1065E probably damaging Het
4932438A13Rik A G 3: 36,987,635 T2721A probably damaging Het
4933402N03Rik T C 7: 131,146,131 N44S probably benign Het
Abca13 A G 11: 9,291,701 D1188G probably benign Het
Abcb11 C T 2: 69,277,884 probably benign Het
Abcc8 A T 7: 46,108,820 I1274N probably damaging Het
Adamtsl1 G A 4: 86,341,198 C827Y probably damaging Het
Agap3 T A 5: 24,501,243 V369E probably damaging Het
Ankrd13b G A 11: 77,473,041 R195C probably damaging Het
Ap3b1 A G 13: 94,472,938 probably benign Het
Arhgef40 A T 14: 52,004,907 probably benign Het
Atad5 A G 11: 80,100,356 I692V probably benign Het
Atp5b G T 10: 128,086,174 R310L possibly damaging Het
AY358078 A T 14: 51,803,532 M103L unknown Het
Bcl9l T G 9: 44,509,518 V1370G probably benign Het
Bglap3 T A 3: 88,369,137 Q38L probably damaging Het
Cd38 T C 5: 43,868,891 F6L probably damaging Het
Cela3a A C 4: 137,404,468 V138G probably damaging Het
Clvs1 T A 4: 9,424,241 I229N probably damaging Het
Cpne1 G A 2: 156,079,419 H16Y probably damaging Het
Ctc1 T C 11: 69,035,507 L1069P probably damaging Het
Ctgf G T 10: 24,597,515 M317I possibly damaging Het
Dgkd G A 1: 87,936,900 S996N probably null Het
Dnah9 A T 11: 66,075,135 M1685K probably null Het
Dnajb12 C T 10: 59,879,801 R42* probably null Het
Dock5 T C 14: 67,817,518 Q633R probably damaging Het
Dync2h1 A G 9: 7,155,180 M868T probably benign Het
Enpp1 G T 10: 24,672,052 H208Q probably benign Het
Epha7 T A 4: 28,821,292 D152E probably damaging Het
Fancd2 T C 6: 113,555,130 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gm10964 A T 3: 103,739,429 probably null Het
Gm7075 G T 10: 63,421,602 C46* probably null Het
Gpbar1 T C 1: 74,278,981 F128L probably benign Het
Gsx2 T A 5: 75,077,065 M226K probably benign Het
Gucd1 T C 10: 75,511,266 D50G possibly damaging Het
Has1 A G 17: 17,843,746 Y544H probably benign Het
Hc A T 2: 35,013,571 Y1024N probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ift122 T A 6: 115,905,902 H659Q probably benign Het
Itga2 T C 13: 114,853,899 Q902R probably benign Het
Itgb2l T C 16: 96,434,701 K181E possibly damaging Het
Jak3 A T 8: 71,682,397 H558L probably damaging Het
Kcnh8 A G 17: 52,725,858 T58A probably benign Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt33a C T 11: 100,012,329 probably benign Het
Magi2 A T 5: 20,661,359 probably benign Het
Map4 G A 9: 110,039,850 probably benign Het
Map4k4 T A 1: 40,006,822 S754T probably damaging Het
Mapk8ip3 A G 17: 24,914,450 probably benign Het
Mib1 A G 18: 10,804,773 S918G probably benign Het
Mipol1 T A 12: 57,457,177 V377D probably damaging Het
Mlh1 T C 9: 111,241,556 T364A probably benign Het
Mta1 C T 12: 113,131,321 Q400* probably null Het
Mthfd1l C G 10: 4,090,006 R806G probably benign Het
Myh13 C A 11: 67,348,815 N730K probably damaging Het
Myom1 A G 17: 71,084,306 K937E probably damaging Het
Naxd T C 8: 11,510,224 probably benign Het
Negr1 G T 3: 157,016,267 K159N probably damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1170 A T 2: 88,224,155 Y292* probably null Het
Olfr137 A G 17: 38,304,658 S268P probably damaging Het
Olfr397 T C 11: 73,964,880 S91P probably benign Het
Olfr584 T C 7: 103,085,590 I19T probably damaging Het
Olfr620 C T 7: 103,611,997 A119T probably benign Het
Pcsk6 G A 7: 65,927,249 S58N probably benign Het
Pdzrn3 G A 6: 101,150,570 T1045I possibly damaging Het
Pitrm1 T C 13: 6,568,714 L641P probably damaging Het
Pkd1l1 G T 11: 8,929,430 H474N probably damaging Het
Pltp A G 2: 164,852,461 probably benign Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Racgap1 A T 15: 99,639,832 probably benign Het
Rhbg A G 3: 88,254,498 V50A probably benign Het
Rnf135 G A 11: 80,183,950 V12M probably damaging Het
Rufy2 T C 10: 62,993,170 V117A probably damaging Het
Safb A G 17: 56,605,630 M866V probably benign Het
Slc35c2 G T 2: 165,280,815 T183K probably damaging Het
Slc39a7 A G 17: 34,029,538 L377P probably damaging Het
Slit1 G A 19: 41,608,311 probably benign Het
Spaca9 G A 2: 28,693,010 H133Y probably damaging Het
Spout1 A G 2: 30,174,971 F339S probably benign Het
Stat2 T C 10: 128,276,509 M6T probably benign Het
Swt1 T A 1: 151,411,270 H157L probably benign Het
Syne2 A G 12: 76,038,940 N147D possibly damaging Het
Tmem2 A T 19: 21,797,345 N117I possibly damaging Het
Tmem222 A T 4: 133,277,591 M45K possibly damaging Het
Tmem30a T A 9: 79,777,285 H95L probably damaging Het
Tns3 A C 11: 8,547,262 probably benign Het
Trpm3 A G 19: 22,698,778 I103V probably benign Het
Ube2n T C 10: 95,541,344 F57S probably benign Het
Vil1 T C 1: 74,421,340 S219P possibly damaging Het
Wdfy4 A G 14: 33,140,738 probably benign Het
Wdr7 T C 18: 63,791,843 S966P probably benign Het
Wnt8a A G 18: 34,544,847 N103D probably damaging Het
Zfp523 G A 17: 28,200,445 E186K possibly damaging Het
Zfp791 A T 8: 85,109,980 D418E probably benign Het
Zscan20 A G 4: 128,591,889 V192A probably benign Het
Other mutations in St6gal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:St6gal2 APN 17 55482595 missense probably damaging 1.00
R0652:St6gal2 UTSW 17 55498289 missense probably benign
R1456:St6gal2 UTSW 17 55490931 splice site probably benign
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1676:St6gal2 UTSW 17 55496395 critical splice donor site probably null
R2092:St6gal2 UTSW 17 55510266 missense probably damaging 1.00
R3120:St6gal2 UTSW 17 55482110 missense probably benign 0.00
R3875:St6gal2 UTSW 17 55482697 missense probably benign 0.02
R3928:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R3929:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R4512:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4513:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4514:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4564:St6gal2 UTSW 17 55482647 missense probably damaging 1.00
R4701:St6gal2 UTSW 17 55496344 missense probably damaging 1.00
R4716:St6gal2 UTSW 17 55510366 missense probably benign 0.01
R6034:St6gal2 UTSW 17 55482981 missense probably benign
R6034:St6gal2 UTSW 17 55482981 missense probably benign
R6356:St6gal2 UTSW 17 55482013 missense probably damaging 1.00
R6455:St6gal2 UTSW 17 55482513 missense probably benign 0.01
R8221:St6gal2 UTSW 17 55490934 splice site probably null
Z1177:St6gal2 UTSW 17 55482897 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CATGTCCAGAGTCTCTTGGGAAACG -3'
(R):5'- GCAGCACTTTGCTTGCATCCAAAC -3'

Sequencing Primer
(F):5'- GACCTTTTGTCTTTCAGAAGTCAAG -3'
(R):5'- CTTCTGGGCAAAGAGGGTTCC -3'
Posted On2013-05-29