Incidental Mutation 'R5620:Cdk12'
ID439800
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission 043160-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5620 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98210983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 556 (I556V)
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect unknown
Transcript: ENSMUST00000003203
AA Change: I556V
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119
AA Change: I556V

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107538
AA Change: I556V
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119
AA Change: I556V

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107539
AA Change: I556V
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119
AA Change: I556V

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,338,391 S511A probably benign Het
Abca3 C T 17: 24,396,470 T845I probably benign Het
Acaa2 G A 18: 74,805,874 A377T possibly damaging Het
Adcy4 C A 14: 55,772,367 E743* probably null Het
Ahnak T A 19: 9,013,094 L3914* probably null Het
Akap1 G T 11: 88,845,517 N106K possibly damaging Het
Arhgap8 A G 15: 84,756,369 S140G probably benign Het
Arid2 C T 15: 96,372,506 T1500I probably benign Het
Atp6v0a2 T A 5: 124,645,969 Y252* probably null Het
BC055324 C A 1: 163,962,044 G641* probably null Het
C4bp A G 1: 130,653,353 S140P probably damaging Het
Cald1 A G 6: 34,762,112 I384M probably damaging Het
Chmp2a T C 7: 13,032,310 S174G probably benign Het
Clybl T A 14: 122,311,343 N52K probably damaging Het
Cyp4a29 C A 4: 115,250,891 S303R probably benign Het
Dab2 T A 15: 6,418,315 D59E probably damaging Het
Dag1 C A 9: 108,209,015 R309L probably damaging Het
Dync1i2 T A 2: 71,258,139 M505K probably benign Het
Eif2b1 A T 5: 124,579,012 M1K probably null Het
Epc1 A G 18: 6,448,917 S577P probably benign Het
Eps8l1 T A 7: 4,460,946 I23N possibly damaging Het
Etl4 A G 2: 20,530,226 E164G probably damaging Het
Gadl1 A T 9: 115,937,162 M1L probably benign Het
Gda T C 19: 21,397,544 D336G probably damaging Het
Grm2 A T 9: 106,650,446 V413D probably damaging Het
Hnrnpll G T 17: 80,038,622 N403K probably damaging Het
Ifit1 T A 19: 34,647,838 F125I probably damaging Het
Igkv5-43 C T 6: 69,823,908 V2I probably benign Het
Kat5 A C 19: 5,609,479 Y44* probably null Het
Klc2 A G 19: 5,112,856 V205A probably damaging Het
Klrb1c T A 6: 128,784,743 T133S possibly damaging Het
Krt20 A G 11: 99,435,457 L157P probably damaging Het
Krt26 G T 11: 99,337,771 T45N possibly damaging Het
Lama2 C T 10: 26,990,880 D2873N probably damaging Het
Lig1 T A 7: 13,286,606 C114S possibly damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Maml2 A T 9: 13,697,320 R21S probably damaging Het
Mrpl35 C T 6: 71,817,736 V83I probably benign Het
Myo3b A G 2: 70,238,910 R498G probably benign Het
Nup153 C A 13: 46,684,006 E1247* probably null Het
Olfr330 A T 11: 58,529,731 M85K probably damaging Het
Pcdhac2 A G 18: 37,144,204 N79S probably benign Het
Pcgf6 C T 19: 47,047,967 G221D probably damaging Het
Phf11b C T 14: 59,321,504 D260N probably benign Het
Pla2g5 T C 4: 138,804,610 M28V possibly damaging Het
Prpf8 T C 11: 75,505,101 S1934P possibly damaging Het
Prrc2c T C 1: 162,673,529 D1235G probably damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rassf8 C T 6: 145,820,181 probably benign Het
Rgs20 T A 1: 4,912,443 E167D probably damaging Het
Rmnd1 G T 10: 4,422,159 A180E probably damaging Het
Rnf103 A G 6: 71,510,008 D541G probably benign Het
Rpl9 G T 5: 65,389,125 Q140K probably benign Het
Sfmbt1 T G 14: 30,784,191 probably null Het
Shank1 C A 7: 44,312,736 D10E unknown Het
Srrm4 G T 5: 116,449,613 probably benign Het
Sucla2 T A 14: 73,595,396 V447E probably damaging Het
Tbc1d1 A G 5: 64,173,712 D78G probably benign Het
Tcp1 T A 17: 12,919,337 probably null Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Thsd7b G A 1: 130,162,936 probably null Het
Tmem63a A G 1: 180,970,246 M621V probably benign Het
Tnxb A T 17: 34,717,530 K2756* probably null Het
Trpm8 G A 1: 88,359,651 probably null Het
Txndc16 C A 14: 45,135,878 V764F possibly damaging Het
Ush2a A T 1: 188,759,823 D3103V possibly damaging Het
Usp22 A T 11: 61,158,380 I381N probably damaging Het
Zfp462 T A 4: 55,013,464 M1810K probably benign Het
Zfp64 T A 2: 168,899,968 M347L possibly damaging Het
Zfp69 T C 4: 120,930,522 D532G probably damaging Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
capsized UTSW 11 98241785 missense unknown
Listing UTSW 11 98224467 nonsense probably null
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1129:Cdk12 UTSW 11 98245375 missense unknown
R1337:Cdk12 UTSW 11 98245671 critical splice donor site probably null
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R2570:Cdk12 UTSW 11 98203792 missense possibly damaging 0.94
R4574:Cdk12 UTSW 11 98220988 intron probably benign
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5252:Cdk12 UTSW 11 98243509 missense unknown
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5779:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6371:Cdk12 UTSW 11 98245288 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
R7205:Cdk12 UTSW 11 98224625 missense unknown
R7307:Cdk12 UTSW 11 98249800 nonsense probably null
R7361:Cdk12 UTSW 11 98210468 nonsense probably null
R7365:Cdk12 UTSW 11 98221084 missense unknown
R7447:Cdk12 UTSW 11 98245280 missense unknown
R7514:Cdk12 UTSW 11 98222658 missense unknown
R7831:Cdk12 UTSW 11 98249827 missense unknown
R7877:Cdk12 UTSW 11 98240835 missense unknown
R7975:Cdk12 UTSW 11 98221102 missense unknown
Z1176:Cdk12 UTSW 11 98203941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTAAACCTGTAGCACCGAAAG -3'
(R):5'- TCATCTCCAGGTAATAGGGGAGG -3'

Sequencing Primer
(F):5'- CCGAAAGAGGTGATTGTTACTTC -3'
(R):5'- TCTTCAGATGTGGAATAGCAGC -3'
Posted On2016-11-08