Incidental Mutation 'R5620:Sfmbt1'
ID439805
Institutional Source Beutler Lab
Gene Symbol Sfmbt1
Ensembl Gene ENSMUSG00000006527
Gene NameScm-like with four mbt domains 1
Synonyms4930442N21Rik, 9330180L21Rik, Smr
MMRRC Submission 043160-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R5620 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30714849-30822721 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 30784191 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054230] [ENSMUST00000112184] [ENSMUST00000227201] [ENSMUST00000227303] [ENSMUST00000228006]
Predicted Effect probably null
Transcript: ENSMUST00000054230
SMART Domains Protein: ENSMUSP00000056744
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112177
SMART Domains Protein: ENSMUSP00000107799
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112184
SMART Domains Protein: ENSMUSP00000107802
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 499 614 3.1e-41 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131706
SMART Domains Protein: ENSMUSP00000117866
Gene: ENSMUSG00000006527

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 7.3e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132451
Predicted Effect probably null
Transcript: ENSMUST00000227201
Predicted Effect probably null
Transcript: ENSMUST00000227303
Predicted Effect probably null
Transcript: ENSMUST00000228006
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares high similarity with the Drosophila Scm (sex comb on midleg) gene. It encodes a protein which contains four malignant brain tumor repeat (mbt) domains and may be involved in antigen recognition. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,338,391 S511A probably benign Het
Abca3 C T 17: 24,396,470 T845I probably benign Het
Acaa2 G A 18: 74,805,874 A377T possibly damaging Het
Adcy4 C A 14: 55,772,367 E743* probably null Het
Ahnak T A 19: 9,013,094 L3914* probably null Het
Akap1 G T 11: 88,845,517 N106K possibly damaging Het
Arhgap8 A G 15: 84,756,369 S140G probably benign Het
Arid2 C T 15: 96,372,506 T1500I probably benign Het
Atp6v0a2 T A 5: 124,645,969 Y252* probably null Het
BC055324 C A 1: 163,962,044 G641* probably null Het
C4bp A G 1: 130,653,353 S140P probably damaging Het
Cald1 A G 6: 34,762,112 I384M probably damaging Het
Cdk12 A G 11: 98,210,983 I556V unknown Het
Chmp2a T C 7: 13,032,310 S174G probably benign Het
Clybl T A 14: 122,311,343 N52K probably damaging Het
Cyp4a29 C A 4: 115,250,891 S303R probably benign Het
Dab2 T A 15: 6,418,315 D59E probably damaging Het
Dag1 C A 9: 108,209,015 R309L probably damaging Het
Dync1i2 T A 2: 71,258,139 M505K probably benign Het
Eif2b1 A T 5: 124,579,012 M1K probably null Het
Epc1 A G 18: 6,448,917 S577P probably benign Het
Eps8l1 T A 7: 4,460,946 I23N possibly damaging Het
Etl4 A G 2: 20,530,226 E164G probably damaging Het
Gadl1 A T 9: 115,937,162 M1L probably benign Het
Gda T C 19: 21,397,544 D336G probably damaging Het
Grm2 A T 9: 106,650,446 V413D probably damaging Het
Hnrnpll G T 17: 80,038,622 N403K probably damaging Het
Ifit1 T A 19: 34,647,838 F125I probably damaging Het
Igkv5-43 C T 6: 69,823,908 V2I probably benign Het
Kat5 A C 19: 5,609,479 Y44* probably null Het
Klc2 A G 19: 5,112,856 V205A probably damaging Het
Klrb1c T A 6: 128,784,743 T133S possibly damaging Het
Krt20 A G 11: 99,435,457 L157P probably damaging Het
Krt26 G T 11: 99,337,771 T45N possibly damaging Het
Lama2 C T 10: 26,990,880 D2873N probably damaging Het
Lig1 T A 7: 13,286,606 C114S possibly damaging Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Maml2 A T 9: 13,697,320 R21S probably damaging Het
Mrpl35 C T 6: 71,817,736 V83I probably benign Het
Myo3b A G 2: 70,238,910 R498G probably benign Het
Nup153 C A 13: 46,684,006 E1247* probably null Het
Olfr330 A T 11: 58,529,731 M85K probably damaging Het
Pcdhac2 A G 18: 37,144,204 N79S probably benign Het
Pcgf6 C T 19: 47,047,967 G221D probably damaging Het
Phf11b C T 14: 59,321,504 D260N probably benign Het
Pla2g5 T C 4: 138,804,610 M28V possibly damaging Het
Prpf8 T C 11: 75,505,101 S1934P possibly damaging Het
Prrc2c T C 1: 162,673,529 D1235G probably damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rassf8 C T 6: 145,820,181 probably benign Het
Rgs20 T A 1: 4,912,443 E167D probably damaging Het
Rmnd1 G T 10: 4,422,159 A180E probably damaging Het
Rnf103 A G 6: 71,510,008 D541G probably benign Het
Rpl9 G T 5: 65,389,125 Q140K probably benign Het
Shank1 C A 7: 44,312,736 D10E unknown Het
Srrm4 G T 5: 116,449,613 probably benign Het
Sucla2 T A 14: 73,595,396 V447E probably damaging Het
Tbc1d1 A G 5: 64,173,712 D78G probably benign Het
Tcp1 T A 17: 12,919,337 probably null Het
Tctn3 C A 19: 40,608,917 E230* probably null Het
Thsd7b G A 1: 130,162,936 probably null Het
Tmem63a A G 1: 180,970,246 M621V probably benign Het
Tnxb A T 17: 34,717,530 K2756* probably null Het
Trpm8 G A 1: 88,359,651 probably null Het
Txndc16 C A 14: 45,135,878 V764F possibly damaging Het
Ush2a A T 1: 188,759,823 D3103V possibly damaging Het
Usp22 A T 11: 61,158,380 I381N probably damaging Het
Zfp462 T A 4: 55,013,464 M1810K probably benign Het
Zfp64 T A 2: 168,899,968 M347L possibly damaging Het
Zfp69 T C 4: 120,930,522 D532G probably damaging Het
Other mutations in Sfmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Sfmbt1 APN 14 30810311 missense probably damaging 1.00
IGL01351:Sfmbt1 APN 14 30769820 missense probably benign 0.00
IGL01478:Sfmbt1 APN 14 30811521 missense probably damaging 1.00
IGL01632:Sfmbt1 APN 14 30817712 missense probably damaging 1.00
IGL02252:Sfmbt1 APN 14 30817733 missense probably damaging 1.00
IGL02456:Sfmbt1 APN 14 30785880 missense probably damaging 0.99
IGL02651:Sfmbt1 APN 14 30815537 missense probably damaging 1.00
IGL02967:Sfmbt1 APN 14 30816802 missense probably damaging 1.00
PIT4142001:Sfmbt1 UTSW 14 30816757 unclassified probably null
PIT4519001:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
PIT4531001:Sfmbt1 UTSW 14 30796326 missense probably benign 0.00
R0043:Sfmbt1 UTSW 14 30816807 missense probably damaging 0.99
R0389:Sfmbt1 UTSW 14 30811507 missense probably damaging 1.00
R0395:Sfmbt1 UTSW 14 30787617 splice site probably benign
R0562:Sfmbt1 UTSW 14 30811373 intron probably null
R1083:Sfmbt1 UTSW 14 30787541 missense possibly damaging 0.92
R1900:Sfmbt1 UTSW 14 30802567 missense probably damaging 1.00
R2447:Sfmbt1 UTSW 14 30773893 missense possibly damaging 0.62
R3104:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3105:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3106:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R4038:Sfmbt1 UTSW 14 30787492 missense probably damaging 1.00
R5118:Sfmbt1 UTSW 14 30790770 missense probably damaging 1.00
R5227:Sfmbt1 UTSW 14 30815254 critical splice donor site probably null
R5286:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5287:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5295:Sfmbt1 UTSW 14 30774029 missense probably damaging 1.00
R6113:Sfmbt1 UTSW 14 30815184 missense possibly damaging 0.68
R6139:Sfmbt1 UTSW 14 30811418 missense probably damaging 1.00
R6429:Sfmbt1 UTSW 14 30773911 missense probably damaging 1.00
R6657:Sfmbt1 UTSW 14 30766096 missense possibly damaging 0.50
R6955:Sfmbt1 UTSW 14 30766034 start gained probably benign
R6957:Sfmbt1 UTSW 14 30787589 missense probably benign 0.00
R7206:Sfmbt1 UTSW 14 30811373 intron probably null
R7337:Sfmbt1 UTSW 14 30784739 missense possibly damaging 0.62
R7451:Sfmbt1 UTSW 14 30816811 missense probably benign 0.02
R7684:Sfmbt1 UTSW 14 30810354 missense probably damaging 1.00
R7798:Sfmbt1 UTSW 14 30816802 missense probably damaging 1.00
X0064:Sfmbt1 UTSW 14 30815205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGACTCTTTAAGCACTTGG -3'
(R):5'- TGAGCATCAAATATTGGTCAGAGG -3'

Sequencing Primer
(F):5'- GCTTGTTACTGTTGTGGAGAAC -3'
(R):5'- TCAAATATTGGTCAGAGGAAAAGTC -3'
Posted On2016-11-08