Mutagenetix > Incidental Mutations

Incidental Mutation 'R5620:Hnrnpll'

439819

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpll

Ensembl Gene

ENSMUSG00000024095

Gene Name

heterogeneous nuclear ribonucleoprotein L-like

Synonyms

2510028H02Rik, Hnrpll, 2810036L13Rik

MMRRC Submission

043160-MU

Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene?

Probably essential (E-score: 0.844) question?

Stock #

R5620 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80029487-80062334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80038622 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 403 (N403K)

Ref Sequence

ENSEMBL: ENSMUSP00000139372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061331
AA Change: N403K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: N403K

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183516

Predicted Effect

probably benign
Transcript: ENSMUST00000184297

SMART Domains

Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184578

Predicted Effect

probably damaging
Transcript: ENSMUST00000184635
AA Change: N403K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: N403K

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4⁺ T cell counts are lower, with a reduction of naï¿½ve CD44^lo T cells occurring as mice age. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	A	C	15: 102,338,391	S511A	probably benign	Het
Abca3	C	T	17: 24,396,470	T845I	probably benign	Het
Acaa2	G	A	18: 74,805,874	A377T	possibly damaging	Het
Adcy4	C	A	14: 55,772,367	E743*	probably null	Het
Ahnak	T	A	19: 9,013,094	L3914*	probably null	Het
Akap1	G	T	11: 88,845,517	N106K	possibly damaging	Het
Arhgap8	A	G	15: 84,756,369	S140G	probably benign	Het
Arid2	C	T	15: 96,372,506	T1500I	probably benign	Het
Atp6v0a2	T	A	5: 124,645,969	Y252*	probably null	Het
BC055324	C	A	1: 163,962,044	G641*	probably null	Het
C4bp	A	G	1: 130,653,353	S140P	probably damaging	Het
Cald1	A	G	6: 34,762,112	I384M	probably damaging	Het
Cdk12	A	G	11: 98,210,983	I556V	unknown	Het
Chmp2a	T	C	7: 13,032,310	S174G	probably benign	Het
Clybl	T	A	14: 122,311,343	N52K	probably damaging	Het
Cyp4a29	C	A	4: 115,250,891	S303R	probably benign	Het
Dab2	T	A	15: 6,418,315	D59E	probably damaging	Het
Dag1	C	A	9: 108,209,015	R309L	probably damaging	Het
Dync1i2	T	A	2: 71,258,139	M505K	probably benign	Het
Eif2b1	A	T	5: 124,579,012	M1K	probably null	Het
Epc1	A	G	18: 6,448,917	S577P	probably benign	Het
Eps8l1	T	A	7: 4,460,946	I23N	possibly damaging	Het
Etl4	A	G	2: 20,530,226	E164G	probably damaging	Het
Gadl1	A	T	9: 115,937,162	M1L	probably benign	Het
Gda	T	C	19: 21,397,544	D336G	probably damaging	Het
Grm2	A	T	9: 106,650,446	V413D	probably damaging	Het
Ifit1	T	A	19: 34,647,838	F125I	probably damaging	Het
Igkv5-43	C	T	6: 69,823,908	V2I	probably benign	Het
Kat5	A	C	19: 5,609,479	Y44*	probably null	Het
Klc2	A	G	19: 5,112,856	V205A	probably damaging	Het
Klrb1c	T	A	6: 128,784,743	T133S	possibly damaging	Het
Krt20	A	G	11: 99,435,457	L157P	probably damaging	Het
Krt26	G	T	11: 99,337,771	T45N	possibly damaging	Het
Lama2	C	T	10: 26,990,880	D2873N	probably damaging	Het
Lig1	T	A	7: 13,286,606	C114S	possibly damaging	Het
Lonp1	G	C	17: 56,620,263	A330G	probably benign	Het
Maml2	A	T	9: 13,697,320	R21S	probably damaging	Het
Mrpl35	C	T	6: 71,817,736	V83I	probably benign	Het
Myo3b	A	G	2: 70,238,910	R498G	probably benign	Het
Nup153	C	A	13: 46,684,006	E1247*	probably null	Het
Olfr330	A	T	11: 58,529,731	M85K	probably damaging	Het
Pcdhac2	A	G	18: 37,144,204	N79S	probably benign	Het
Pcgf6	C	T	19: 47,047,967	G221D	probably damaging	Het
Phf11b	C	T	14: 59,321,504	D260N	probably benign	Het
Pla2g5	T	C	4: 138,804,610	M28V	possibly damaging	Het
Prpf8	T	C	11: 75,505,101	S1934P	possibly damaging	Het
Prrc2c	T	C	1: 162,673,529	D1235G	probably damaging	Het
Rasgrp2	T	C	19: 6,405,001	S254P	probably damaging	Het
Rassf8	C	T	6: 145,820,181		probably benign	Het
Rgs20	T	A	1: 4,912,443	E167D	probably damaging	Het
Rmnd1	G	T	10: 4,422,159	A180E	probably damaging	Het
Rnf103	A	G	6: 71,510,008	D541G	probably benign	Het
Rpl9	G	T	5: 65,389,125	Q140K	probably benign	Het
Sfmbt1	T	G	14: 30,784,191		probably null	Het
Shank1	C	A	7: 44,312,736	D10E	unknown	Het
Srrm4	G	T	5: 116,449,613		probably benign	Het
Sucla2	T	A	14: 73,595,396	V447E	probably damaging	Het
Tbc1d1	A	G	5: 64,173,712	D78G	probably benign	Het
Tcp1	T	A	17: 12,919,337		probably null	Het
Tctn3	C	A	19: 40,608,917	E230*	probably null	Het
Thsd7b	G	A	1: 130,162,936		probably null	Het
Tmem63a	A	G	1: 180,970,246	M621V	probably benign	Het
Tnxb	A	T	17: 34,717,530	K2756*	probably null	Het
Trpm8	G	A	1: 88,359,651		probably null	Het
Txndc16	C	A	14: 45,135,878	V764F	possibly damaging	Het
Ush2a	A	T	1: 188,759,823	D3103V	possibly damaging	Het
Usp22	A	T	11: 61,158,380	I381N	probably damaging	Het
Zfp462	T	A	4: 55,013,464	M1810K	probably benign	Het
Zfp64	T	A	2: 168,899,968	M347L	possibly damaging	Het
Zfp69	T	C	4: 120,930,522	D532G	probably damaging	Het

Other mutations in Hnrnpll

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
thunder	APN	17	80053571	missense	probably damaging	1.00
IGL01989:Hnrnpll	APN	17	80038740	missense	probably benign	0.15
IGL02093:Hnrnpll	APN	17	80044504	missense	probably benign	0.00
IGL02141:Hnrnpll	APN	17	80050713	missense	probably benign	0.02
IGL02749:Hnrnpll	APN	17	80061991	start codon destroyed	probably null
IGL03213:Hnrnpll	APN	17	80034098	missense	probably damaging	1.00
Grell	UTSW	17	80034105	missense	probably damaging	1.00
Lindsley	UTSW	17	80049847	missense	probably damaging	1.00
R0477:Hnrnpll	UTSW	17	80061832	missense	unknown
R1599:Hnrnpll	UTSW	17	80053625	missense	unknown
R1700:Hnrnpll	UTSW	17	80034105	missense	probably benign	0.18
R1838:Hnrnpll	UTSW	17	80038623	missense	probably damaging	1.00
R1907:Hnrnpll	UTSW	17	80035329	critical splice donor site	probably null
R1978:Hnrnpll	UTSW	17	80044518	missense	probably benign	0.01
R2079:Hnrnpll	UTSW	17	80035377	missense	probably benign	0.01
R4061:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4062:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4064:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4226:Hnrnpll	UTSW	17	80049805	critical splice donor site	probably null
R4625:Hnrnpll	UTSW	17	80050862	nonsense	probably null
R5175:Hnrnpll	UTSW	17	80034070	missense	possibly damaging	0.83
R5232:Hnrnpll	UTSW	17	80038678	missense	probably damaging	1.00
R5978:Hnrnpll	UTSW	17	80034191	missense	probably damaging	1.00
R6183:Hnrnpll	UTSW	17	80049876	missense	possibly damaging	0.46
R6374:Hnrnpll	UTSW	17	80049874	missense	possibly damaging	0.51
R7120:Hnrnpll	UTSW	17	80034057	missense	probably benign	0.01
R7429:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7430:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7576:Hnrnpll	UTSW	17	80044514	missense	possibly damaging	0.91
R8001:Hnrnpll	UTSW	17	80038723	nonsense	probably null
R8010:Hnrnpll	UTSW	17	80061956	missense	unknown
R8060:Hnrnpll	UTSW	17	80034105	missense	probably damaging	1.00
R8068:Hnrnpll	UTSW	17	80050852	missense	possibly damaging	0.80
R8381:Hnrnpll	UTSW	17	80030491	missense	probably damaging	1.00
Z1177:Hnrnpll	UTSW	17	80048610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATTGCTGCTTTGGACCTTG -3'
(R):5'- GCTACTGCCTTTACCAAGTCG -3'

Sequencing Primer
(F):5'- TGGACCTTGCTCTTTATACTGG -3'
(R):5'- CCAAGTCGTTATAGAATGGGCTC -3'

Posted On

2016-11-08