Mutagenetix > Incidental Mutation

Incidental Mutation 'R5631:Mrc1'

439833

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

043282-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R5631 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 14333383 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1355 (K1355*)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000028045
AA Change: K1355*

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: K1355*

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146168

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	C	A	11: 72,067,590 (GRCm39)	V567L	possibly damaging	Het
Abraxas1	T	G	5: 100,965,840 (GRCm39)	Y68S	probably damaging	Het
Adamtsl1	C	T	4: 86,195,160 (GRCm39)	Q543*	probably null	Het
Anapc1	T	C	2: 128,499,137 (GRCm39)	Y845C	possibly damaging	Het
Ap4m1	A	G	5: 138,173,051 (GRCm39)	*98W	probably null	Het
Clock	G	A	5: 76,378,185 (GRCm39)	P572S	probably benign	Het
Cramp1	T	A	17: 25,204,577 (GRCm39)	T275S	possibly damaging	Het
Dock3	T	C	9: 106,832,898 (GRCm39)	S1038G	probably benign	Het
Fancm	T	C	12: 65,160,617 (GRCm39)	V1397A	probably damaging	Het
Fn1	T	C	1: 71,629,355 (GRCm39)	T2203A	probably damaging	Het
Gm57858	G	C	3: 36,101,026 (GRCm39)	Q49E	probably damaging	Het
Heatr5a	T	A	12: 52,002,310 (GRCm39)	I209F	probably benign	Het
Hfm1	A	G	5: 107,052,629 (GRCm39)	S285P	probably damaging	Het
Hpx	A	T	7: 105,244,808 (GRCm39)	C126S	probably damaging	Het
Ipo4	A	G	14: 55,869,526 (GRCm39)	V378A	probably damaging	Het
Ipo4	C	T	14: 55,870,838 (GRCm39)	V265I	probably benign	Het
Kcnv1	T	A	15: 44,972,753 (GRCm39)	T377S	probably damaging	Het
Kmt2a	A	T	9: 44,731,985 (GRCm39)		probably benign	Het
Ldlrad3	T	C	2: 101,900,301 (GRCm39)	D67G	probably damaging	Het
Lrrc71	T	A	3: 87,646,456 (GRCm39)	M535L	probably benign	Het
Mfhas1	G	A	8: 36,055,573 (GRCm39)	R16Q	probably damaging	Het
Mrgprf	A	G	7: 144,862,283 (GRCm39)	I282V	probably benign	Het
Mvb12b	G	T	2: 33,717,715 (GRCm39)	P142Q	probably damaging	Het
Naip6	T	C	13: 100,436,646 (GRCm39)	I626V	probably benign	Het
Ncoa5	T	C	2: 164,855,041 (GRCm39)	D27G	possibly damaging	Het
Nrap	T	G	19: 56,342,553 (GRCm39)	E780A	probably benign	Het
Oplah	T	C	15: 76,189,441 (GRCm39)	I228V	probably benign	Het
Or5w1b	A	T	2: 87,475,952 (GRCm39)	S172T	probably benign	Het
Pkdrej	T	C	15: 85,704,638 (GRCm39)	M433V	probably benign	Het
Polr3h	T	A	15: 81,810,113 (GRCm39)		probably benign	Het
Ppfibp1	T	C	6: 146,898,358 (GRCm39)	Y105H	probably damaging	Het
Rplp2	A	C	7: 141,031,172 (GRCm39)		probably benign	Het
Rps6ka4	T	C	19: 6,808,345 (GRCm39)		probably benign	Het
Rspry1	A	T	8: 95,355,706 (GRCm39)	M1L	possibly damaging	Het
Runx1	C	A	16: 92,492,451 (GRCm39)	R64L	possibly damaging	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Slc9a5	C	T	8: 106,076,141 (GRCm39)	H45Y	possibly damaging	Het
Smc4	T	C	3: 68,937,645 (GRCm39)	I890T	probably benign	Het
Smtnl1	T	C	2: 84,649,098 (GRCm39)	E52G	probably benign	Het
Stag3	T	A	5: 138,294,139 (GRCm39)	I319N	probably damaging	Het
Stt3b	G	A	9: 115,083,913 (GRCm39)	T421I	probably benign	Het
Thumpd1	A	G	7: 119,319,825 (GRCm39)	L47P	probably damaging	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Top2b	T	C	14: 16,409,882 (GRCm38)	Y850H	probably damaging	Het
Trim34a	A	T	7: 103,897,946 (GRCm39)	E158V	probably damaging	Het
Trp53i13	C	A	11: 77,400,419 (GRCm39)		probably null	Het
Ugt3a1	T	C	15: 9,361,971 (GRCm39)	V249A	probably damaging	Het
Vmn1r128	G	A	7: 21,083,300 (GRCm39)	M1I	probably null	Het
Yars1	T	G	4: 129,103,542 (GRCm39)	L297R	probably damaging	Het
Yju2b	G	T	8: 84,990,510 (GRCm39)	Q41K	probably damaging	Het
Zkscan3	A	G	13: 21,578,703 (GRCm39)	L176P	probably damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTTAAGCATTTCATGTTAAGGAG -3'
(R):5'- TCACTCCAAGCTACAGGTAGAG -3'

Sequencing Primer
(F):5'- GGATTATTTTTAACTTGTGCTTTCGC -3'
(R):5'- GCTACAGGTAGAGATTGATCCTC -3'

Posted On

2016-11-08