Incidental Mutation 'R5631:Smtnl1'
ID439835
Institutional Source Beutler Lab
Gene Symbol Smtnl1
Ensembl Gene ENSMUSG00000027077
Gene Namesmoothelin-like 1
SynonymsChasm, 1110030K22Rik
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84811176-84822652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84818754 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 52 (E52G)
Ref Sequence ENSEMBL: ENSMUSP00000028471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028471]
PDB Structure
The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028471
AA Change: E52G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: E52G

DomainStartEndE-ValueType
low complexity region 56 72 N/A INTRINSIC
coiled coil region 124 154 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 260 285 N/A INTRINSIC
CH 345 444 5.55e-18 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Smtnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Smtnl1 APN 2 84818887 missense probably benign
IGL01702:Smtnl1 APN 2 84818690 missense possibly damaging 0.71
IGL01836:Smtnl1 APN 2 84815370 missense probably damaging 1.00
IGL01866:Smtnl1 APN 2 84818745 missense possibly damaging 0.80
IGL01869:Smtnl1 APN 2 84811397 makesense probably null
IGL01989:Smtnl1 APN 2 84818470 missense probably benign 0.22
IGL02247:Smtnl1 APN 2 84817028 splice site probably benign
R1442:Smtnl1 UTSW 2 84818436 missense probably damaging 0.97
R4577:Smtnl1 UTSW 2 84818443 missense possibly damaging 0.50
R5340:Smtnl1 UTSW 2 84815441 missense probably damaging 1.00
R5524:Smtnl1 UTSW 2 84818894 missense probably benign 0.05
R5561:Smtnl1 UTSW 2 84818395 missense probably benign 0.31
R5997:Smtnl1 UTSW 2 84815378 missense probably damaging 1.00
R6050:Smtnl1 UTSW 2 84811453 missense probably damaging 1.00
R6433:Smtnl1 UTSW 2 84818368 missense probably benign 0.03
R7011:Smtnl1 UTSW 2 84818409 missense probably benign 0.01
R8390:Smtnl1 UTSW 2 84815350 nonsense probably null
R8406:Smtnl1 UTSW 2 84818398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTAACTTCATTGGGTTCAGG -3'
(R):5'- CATCTTCTCTTTCTAGACATGGAGC -3'

Sequencing Primer
(F):5'- CCTAACTTCATTGGGTTCAGGTTTTG -3'
(R):5'- CTCTTTCTAGACATGGAGCAGACAG -3'
Posted On2016-11-08