Incidental Mutation 'R5631:Ncoa5'
ID439840
Institutional Source Beutler Lab
Gene Symbol Ncoa5
Ensembl Gene ENSMUSG00000039804
Gene Namenuclear receptor coactivator 5
Synonyms
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165000357-165034867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165013121 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 27 (D27G)
Ref Sequence ENSEMBL: ENSMUSP00000046388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040381] [ENSMUST00000121377] [ENSMUST00000122070] [ENSMUST00000153905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040381
AA Change: D27G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046388
Gene: ENSMUSG00000039804
AA Change: D27G

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 2e-9 SMART
PDB:1V95|A 197 314 3e-79 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 395 427 N/A INTRINSIC
low complexity region 440 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121377
SMART Domains Protein: ENSMUSP00000113872
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
PDB:1V95|A 1 34 2e-15 PDB
low complexity region 44 60 N/A INTRINSIC
low complexity region 87 96 N/A INTRINSIC
low complexity region 115 147 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000122070
AA Change: D27G
SMART Domains Protein: ENSMUSP00000113166
Gene: ENSMUSG00000039804
AA Change: D27G

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 1e-8 SMART
PDB:1V95|A 197 314 2e-80 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127545
Predicted Effect unknown
Transcript: ENSMUST00000153905
AA Change: D27G
SMART Domains Protein: ENSMUSP00000116778
Gene: ENSMUSG00000039804
AA Change: D27G

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coregulator for the alpha and beta estrogen receptors and the orphan nuclear receptor NR1D2. The protein localizes to the nucleus, and is thought to have both coactivator and corepressor functions. Its interaction with nuclear receptors is independent of the AF2 domain on the receptors, which is known to regulate interaction with other coreceptors. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Male mice heterozygous for a knock-out allele exhibit infertility, impaired glucose homeostasis, liver dysplasia and HCC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Ncoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02285:Ncoa5 APN 2 165002840 missense probably damaging 1.00
IGL02624:Ncoa5 APN 2 165013061 missense probably damaging 0.99
R0383:Ncoa5 UTSW 2 165009390 missense possibly damaging 0.67
R0835:Ncoa5 UTSW 2 165002794 missense probably damaging 1.00
R1667:Ncoa5 UTSW 2 165001703 missense probably damaging 1.00
R2110:Ncoa5 UTSW 2 165012918 missense possibly damaging 0.59
R4887:Ncoa5 UTSW 2 165002150 missense probably damaging 1.00
R5100:Ncoa5 UTSW 2 165009389 missense probably damaging 0.99
R6616:Ncoa5 UTSW 2 165010563 nonsense probably null
R6737:Ncoa5 UTSW 2 165002135 missense probably damaging 1.00
R7015:Ncoa5 UTSW 2 165002081 missense probably benign 0.02
R7567:Ncoa5 UTSW 2 165004251 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCCGAAAATCCCTCAGGTC -3'
(R):5'- CCTTCTAGGCCTAACAAGATGGG -3'

Sequencing Primer
(F):5'- AAAATCCCTCAGGTCCCGGG -3'
(R):5'- GCCTAACAAGATGGGTGATTTCC -3'
Posted On2016-11-08