Incidental Mutation 'R5631:Lrrc71'
ID439843
Institutional Source Beutler Lab
Gene Symbol Lrrc71
Ensembl Gene ENSMUSG00000023084
Gene Nameleucine rich repeat containing 71
Synonyms
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87736923-87748625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87739149 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 535 (M535L)
Ref Sequence ENSEMBL: ENSMUSP00000023846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
AA Change: M535L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084
AA Change: M535L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039476
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129113
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152006
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect unknown
Transcript: ENSMUST00000174581
AA Change: M129L
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084
AA Change: M129L

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Lrrc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Lrrc71 APN 3 87745224 splice site probably null
IGL02387:Lrrc71 APN 3 87743071 missense probably damaging 0.96
IGL02632:Lrrc71 APN 3 87743340 missense probably damaging 1.00
IGL02701:Lrrc71 APN 3 87741772 missense probably benign 0.37
R0372:Lrrc71 UTSW 3 87745777 missense probably benign 0.40
R0505:Lrrc71 UTSW 3 87745699 missense probably damaging 0.98
R0827:Lrrc71 UTSW 3 87742645 splice site probably null
R1511:Lrrc71 UTSW 3 87745484 missense probably benign 0.00
R1541:Lrrc71 UTSW 3 87741841 missense possibly damaging 0.87
R1987:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R2054:Lrrc71 UTSW 3 87742673 missense probably damaging 1.00
R2143:Lrrc71 UTSW 3 87745521 nonsense probably null
R2427:Lrrc71 UTSW 3 87746002 missense probably benign
R3700:Lrrc71 UTSW 3 87745878 splice site probably null
R4073:Lrrc71 UTSW 3 87745262 missense probably benign 0.01
R4231:Lrrc71 UTSW 3 87740991 missense probably benign 0.01
R4431:Lrrc71 UTSW 3 87742836 missense possibly damaging 0.59
R4477:Lrrc71 UTSW 3 87742665 missense probably damaging 0.99
R4562:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4563:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4564:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4724:Lrrc71 UTSW 3 87739174 missense probably damaging 0.97
R4826:Lrrc71 UTSW 3 87743308 missense probably benign 0.33
R5156:Lrrc71 UTSW 3 87745787 missense probably benign 0.07
R6182:Lrrc71 UTSW 3 87745794 missense probably benign 0.41
R6558:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R6885:Lrrc71 UTSW 3 87742620 splice site probably null
R7036:Lrrc71 UTSW 3 87748386 missense probably benign 0.00
R7199:Lrrc71 UTSW 3 87743077 missense probably damaging 1.00
R7211:Lrrc71 UTSW 3 87743326 missense possibly damaging 0.92
R7634:Lrrc71 UTSW 3 87742974 missense probably damaging 1.00
R7638:Lrrc71 UTSW 3 87741806 missense probably damaging 1.00
R7695:Lrrc71 UTSW 3 87739462 missense probably damaging 1.00
Z1177:Lrrc71 UTSW 3 87742821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTTCCAAACAGGTATGGAGTG -3'
(R):5'- GTCTCCAAGCCCAAGACTTC -3'

Sequencing Primer
(F):5'- TGATTTTCAAGGAACAGCACAGC -3'
(R):5'- GGCATTGTTCTTTCCTGGA -3'
Posted On2016-11-08