Incidental Mutation 'R5631:Yars'
ID439845
Institutional Source Beutler Lab
Gene Symbol Yars
Ensembl Gene ENSMUSG00000028811
Gene Nametyrosyl-tRNA synthetase
Synonyms
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129189760-129219607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129209749 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 297 (L297R)
Ref Sequence ENSEMBL: ENSMUSP00000101669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106054]
Predicted Effect probably damaging
Transcript: ENSMUST00000106054
AA Change: L297R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811
AA Change: L297R

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133992
SMART Domains Protein: ENSMUSP00000118512
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 75 2.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148619
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Tyrosyl-tRNA synthetase belongs to the class I tRNA synthetase family. Cytokine activities have also been observed for the human tyrosyl-tRNA synthetase, after it is split into two parts, an N-terminal fragment that harbors the catalytic site and a C-terminal fragment found only in the mammalian enzyme. The N-terminal fragment is an interleukin-8-like cytokine, whereas the released C-terminal fragment is an EMAP II-like cytokine. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Yars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Yars APN 4 129206142 missense probably damaging 1.00
IGL02039:Yars APN 4 129215259 missense probably damaging 1.00
IGL03324:Yars APN 4 129210535 missense probably benign 0.01
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0646:Yars UTSW 4 129213939 unclassified probably benign
R0746:Yars UTSW 4 129197286 missense probably damaging 1.00
R0894:Yars UTSW 4 129197155 missense probably damaging 0.97
R2115:Yars UTSW 4 129207923 intron probably null
R2134:Yars UTSW 4 129197199 nonsense probably null
R2189:Yars UTSW 4 129206189 missense probably damaging 1.00
R4190:Yars UTSW 4 129200027 nonsense probably null
R4863:Yars UTSW 4 129189882 unclassified probably benign
R4915:Yars UTSW 4 129210591 unclassified probably benign
R5450:Yars UTSW 4 129197246 missense possibly damaging 0.94
R5789:Yars UTSW 4 129196897 missense probably damaging 1.00
R6384:Yars UTSW 4 129196978 critical splice donor site probably null
R6837:Yars UTSW 4 129209751 missense possibly damaging 0.77
R7713:Yars UTSW 4 129210498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCCTAGCTCAAAAGAAG -3'
(R):5'- CAGTCTCACAGCACACATTTTG -3'

Sequencing Primer
(F):5'- GAGAAAAGGTGTATAATCCATCAAGG -3'
(R):5'- TTTGTATATGAAACCAGGGCAGCC -3'
Posted On2016-11-08