Incidental Mutation 'R5631:Hfm1'
ID439848
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106904763 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 285 (S285P)
Ref Sequence ENSEMBL: ENSMUSP00000142727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148686] [ENSMUST00000200249]
Predicted Effect probably damaging
Transcript: ENSMUST00000112690
AA Change: S285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: S285P

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117588
AA Change: S285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: S285P

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137795
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably damaging
Transcript: ENSMUST00000200249
AA Change: S285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410
AA Change: S285P

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
R8739:Hfm1 UTSW 5 106898505 missense probably damaging 0.96
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTCATCCCTTTACCCTTCAATG -3'
(R):5'- CTGATTGCCATGTCTCCATATATTCAG -3'

Sequencing Primer
(F):5'- ATCCCTTTACCCTTCAATGAAATTC -3'
(R):5'- TTGAGCCACCATGTGAGTAC -3'
Posted On2016-11-08