Incidental Mutation 'R5631:Thumpd1'
ID439855
Institutional Source Beutler Lab
Gene Symbol Thumpd1
Ensembl Gene ENSMUSG00000030942
Gene NameTHUMP domain containing 1
Synonyms6330575P11Rik
MMRRC Submission 043282-MU
Accession Numbers

Genbank: NM_145585; MGI: 2444479

Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5631 (G1)
Quality Score214
Status Not validated
Chromosome7
Chromosomal Location119715093-119720798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119720602 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 47 (L47P)
Ref Sequence ENSEMBL: ENSMUSP00000033236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033236]
Predicted Effect probably damaging
Transcript: ENSMUST00000033236
AA Change: L47P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033236
Gene: ENSMUSG00000030942
AA Change: L47P

DomainStartEndE-ValueType
THUMP 161 254 4.5e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209175
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Thumpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Thumpd1 APN 7 119717009 missense possibly damaging 0.95
IGL01151:Thumpd1 APN 7 119718195 missense probably damaging 0.97
IGL01327:Thumpd1 APN 7 119720702 missense probably benign 0.12
IGL02140:Thumpd1 APN 7 119717009 missense possibly damaging 0.95
IGL02945:Thumpd1 APN 7 119716747 missense possibly damaging 0.48
F6893:Thumpd1 UTSW 7 119720576 nonsense probably null
R4153:Thumpd1 UTSW 7 119720593 missense probably damaging 1.00
R4934:Thumpd1 UTSW 7 119716779 missense probably benign 0.00
R5475:Thumpd1 UTSW 7 119720720 missense probably benign
R6123:Thumpd1 UTSW 7 119717009 missense probably damaging 1.00
R6292:Thumpd1 UTSW 7 119720674 missense probably benign 0.38
R6351:Thumpd1 UTSW 7 119720605 missense possibly damaging 0.94
R7565:Thumpd1 UTSW 7 119716862 nonsense probably null
R8139:Thumpd1 UTSW 7 119720585 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTCATTCAAGCACTGTACTGG -3'
(R):5'- AAACTGTCGCGTACGTGTGAC -3'

Sequencing Primer
(F):5'- CAAGCACTGTACTGGCGCTTTG -3'
(R):5'- TCCGCGCAGACGAAGAC -3'
Posted On2016-11-08