Incidental Mutation 'R5631:Slc9a5'
ID439862
Institutional Source Beutler Lab
Gene Symbol Slc9a5
Ensembl Gene ENSMUSG00000014786
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 5
SynonymsLOC277973
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5631 (G1)
Quality Score176
Status Not validated
Chromosome8
Chromosomal Location105348843-105369881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105349509 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 45 (H45Y)
Ref Sequence ENSEMBL: ENSMUSP00000072893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000073149]
Predicted Effect probably benign
Transcript: ENSMUST00000014922
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000073149
AA Change: H45Y

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072893
Gene: ENSMUSG00000014786
AA Change: H45Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 39 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 458 9.8e-89 PFAM
low complexity region 705 723 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132777
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Slc9a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Slc9a5 APN 8 105349443 missense probably damaging 0.99
IGL02339:Slc9a5 APN 8 105358459 missense probably damaging 1.00
IGL03220:Slc9a5 APN 8 105368020 missense probably benign 0.09
P0026:Slc9a5 UTSW 8 105355291 missense probably damaging 1.00
R0680:Slc9a5 UTSW 8 105355907 missense probably null 1.00
R0990:Slc9a5 UTSW 8 105359446 missense probably damaging 1.00
R1440:Slc9a5 UTSW 8 105355153 missense possibly damaging 0.91
R1625:Slc9a5 UTSW 8 105368123 missense possibly damaging 0.88
R1737:Slc9a5 UTSW 8 105368134 missense probably damaging 1.00
R4169:Slc9a5 UTSW 8 105357400 missense possibly damaging 0.77
R4209:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4210:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4211:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4345:Slc9a5 UTSW 8 105349455 missense probably benign
R4665:Slc9a5 UTSW 8 105368128 missense probably damaging 1.00
R5058:Slc9a5 UTSW 8 105355858 missense probably benign 0.03
R5553:Slc9a5 UTSW 8 105357040 missense probably damaging 1.00
R5574:Slc9a5 UTSW 8 105364691 missense probably benign 0.12
R5645:Slc9a5 UTSW 8 105357013 missense probably benign 0.00
R5856:Slc9a5 UTSW 8 105357165 missense possibly damaging 0.58
R5907:Slc9a5 UTSW 8 105357175 critical splice donor site probably null
R6481:Slc9a5 UTSW 8 105358393 nonsense probably null
R6799:Slc9a5 UTSW 8 105363968 missense possibly damaging 0.84
R6834:Slc9a5 UTSW 8 105364684 missense probably benign 0.00
R6938:Slc9a5 UTSW 8 105353432 missense probably damaging 1.00
R7064:Slc9a5 UTSW 8 105349446 missense possibly damaging 0.91
R7095:Slc9a5 UTSW 8 105357636 missense probably benign 0.16
R7152:Slc9a5 UTSW 8 105368393 missense probably benign 0.03
R7303:Slc9a5 UTSW 8 105356713 missense probably damaging 0.99
R7508:Slc9a5 UTSW 8 105363253 splice site probably null
R7583:Slc9a5 UTSW 8 105363272 missense possibly damaging 0.62
X0058:Slc9a5 UTSW 8 105355305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTGCTAGGATCCTGGGC -3'
(R):5'- CAAGACGCAAATCTGGAGACCTAG -3'

Sequencing Primer
(F):5'- ATCGGAGCTCGGATTGGG -3'
(R):5'- CAAATCTGGAGACCTAGGGGCTTG -3'
Posted On2016-11-08