Incidental Mutation 'R5631:Ugt3a2'
ID439876
Institutional Source Beutler Lab
Gene Symbol Ugt3a2
Ensembl Gene ENSMUSG00000049152
Gene NameUDP glycosyltransferases 3 family, polypeptide A2
Synonyms
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9335550-9370955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9361885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000072236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072403]
Predicted Effect probably damaging
Transcript: ENSMUST00000072403
AA Change: V249A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072236
Gene: ENSMUSG00000049152
AA Change: V249A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.1e-99 PFAM
Pfam:Glyco_tran_28_C 307 450 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144755
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cramp1l T A 17: 24,985,603 T275S possibly damaging Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Ugt3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ugt3a2 APN 15 9367268 missense probably damaging 0.99
IGL01131:Ugt3a2 APN 15 9365162 missense probably damaging 1.00
IGL01627:Ugt3a2 APN 15 9335720 missense probably damaging 1.00
IGL01746:Ugt3a2 APN 15 9361668 missense probably damaging 1.00
IGL01949:Ugt3a2 APN 15 9335729 missense probably damaging 1.00
IGL02213:Ugt3a2 APN 15 9370224 missense probably benign 0.00
IGL02407:Ugt3a2 APN 15 9365230 nonsense probably null
IGL02588:Ugt3a2 APN 15 9361456 missense probably benign
IGL02894:Ugt3a2 APN 15 9367401 missense probably damaging 1.00
IGL02966:Ugt3a2 APN 15 9370068 missense probably damaging 1.00
IGL03385:Ugt3a2 APN 15 9338738 missense probably damaging 0.99
IGL03493:Ugt3a2 APN 15 9361483 missense probably damaging 0.96
R0554:Ugt3a2 UTSW 15 9351120 missense probably benign 0.14
R0833:Ugt3a2 UTSW 15 9370150 missense probably damaging 0.96
R1071:Ugt3a2 UTSW 15 9367368 missense possibly damaging 0.82
R1513:Ugt3a2 UTSW 15 9361524 missense probably benign 0.07
R1844:Ugt3a2 UTSW 15 9351168 missense probably benign 0.07
R1874:Ugt3a2 UTSW 15 9365351 missense probably damaging 1.00
R2305:Ugt3a2 UTSW 15 9351117 missense probably benign
R3052:Ugt3a2 UTSW 15 9365288 missense probably damaging 1.00
R3755:Ugt3a2 UTSW 15 9367412 missense probably benign 0.21
R3945:Ugt3a2 UTSW 15 9370098 missense possibly damaging 0.91
R4135:Ugt3a2 UTSW 15 9338724 missense probably damaging 0.98
R4261:Ugt3a2 UTSW 15 9335793 splice site probably null
R4438:Ugt3a2 UTSW 15 9351197 missense probably benign 0.01
R4570:Ugt3a2 UTSW 15 9338721 missense probably benign 0.12
R4791:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R4957:Ugt3a2 UTSW 15 9365188 missense probably benign 0.27
R5011:Ugt3a2 UTSW 15 9365287 missense probably damaging 1.00
R5035:Ugt3a2 UTSW 15 9361618 missense probably benign 0.01
R5554:Ugt3a2 UTSW 15 9370201 missense probably damaging 1.00
R5573:Ugt3a2 UTSW 15 9361683 missense probably damaging 1.00
R5696:Ugt3a2 UTSW 15 9361448 splice site silent
R6265:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R6302:Ugt3a2 UTSW 15 9365311 missense probably damaging 1.00
R6311:Ugt3a2 UTSW 15 9361518 nonsense probably null
R6680:Ugt3a2 UTSW 15 9370068 missense probably damaging 1.00
R8229:Ugt3a2 UTSW 15 9367377 missense probably damaging 0.99
R8296:Ugt3a2 UTSW 15 9361938 missense probably benign 0.18
Z1177:Ugt3a2 UTSW 15 9367257 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGACCAAATGGACTTCTGGGG -3'
(R):5'- AGTGTAGGCTGCAAATATCTCCC -3'

Sequencing Primer
(F):5'- GCCGAGTGAAGAACTTTCTGATG -3'
(R):5'- TCAGGACATCTCTGACAAGTG -3'
Posted On2016-11-08