Incidental Mutation 'R5631:Cramp1l'
ID439883
Institutional Source Beutler Lab
Gene Symbol Cramp1l
Ensembl Gene ENSMUSG00000038002
Gene Namecramped chromatin regulator homolog 1
Synonyms5830477H08Rik, Tce4
MMRRC Submission 043282-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5631 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24961228-25015230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24985603 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 275 (T275S)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073337
AA Change: T275S

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: T275S

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,176,764 V567L possibly damaging Het
Abraxas1 T G 5: 100,817,974 Y68S probably damaging Het
Adamtsl1 C T 4: 86,276,923 Q543* probably null Het
Anapc1 T C 2: 128,657,217 Y845C possibly damaging Het
Ap4m1 A G 5: 138,174,789 *98W probably null Het
Ccdc130 G T 8: 84,263,881 Q41K probably damaging Het
Ccdc144b G C 3: 36,046,877 Q49E probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Dock3 T C 9: 106,955,699 S1038G probably benign Het
Fancm T C 12: 65,113,843 V1397A probably damaging Het
Fn1 T C 1: 71,590,196 T2203A probably damaging Het
Heatr5a T A 12: 51,955,527 I209F probably benign Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hpx A T 7: 105,595,601 C126S probably damaging Het
Ipo4 A G 14: 55,632,069 V378A probably damaging Het
Ipo4 C T 14: 55,633,381 V265I probably benign Het
Kcnv1 T A 15: 45,109,357 T377S probably damaging Het
Kmt2a A T 9: 44,820,688 probably benign Het
Ldlrad3 T C 2: 102,069,956 D67G probably damaging Het
Lrrc71 T A 3: 87,739,149 M535L probably benign Het
Mfhas1 G A 8: 35,588,419 R16Q probably damaging Het
Mrc1 A T 2: 14,328,572 K1355* probably null Het
Mrgprf A G 7: 145,308,546 I282V probably benign Het
Mvb12b G T 2: 33,827,703 P142Q probably damaging Het
Naip6 T C 13: 100,300,138 I626V probably benign Het
Ncoa5 T C 2: 165,013,121 D27G possibly damaging Het
Nrap T G 19: 56,354,121 E780A probably benign Het
Olfr1133 A T 2: 87,645,608 S172T probably benign Het
Oplah T C 15: 76,305,241 I228V probably benign Het
Pkdrej T C 15: 85,820,437 M433V probably benign Het
Polr3h T A 15: 81,925,912 probably benign Het
Ppfibp1 T C 6: 146,996,860 Y105H probably damaging Het
Rplp2 A C 7: 141,451,259 probably benign Het
Rps6ka4 T C 19: 6,830,977 probably benign Het
Rspry1 A T 8: 94,629,078 M1L possibly damaging Het
Runx1 C A 16: 92,695,563 R64L possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc9a5 C T 8: 105,349,509 H45Y possibly damaging Het
Smc4 T C 3: 69,030,312 I890T probably benign Het
Smtnl1 T C 2: 84,818,754 E52G probably benign Het
Stag3 T A 5: 138,295,877 I319N probably damaging Het
Stt3b G A 9: 115,254,845 T421I probably benign Het
Thumpd1 A G 7: 119,720,602 L47P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b T C 14: 16,409,882 Y850H probably damaging Het
Trim34a A T 7: 104,248,739 E158V probably damaging Het
Trp53i13 C A 11: 77,509,593 probably null Het
Ugt3a2 T C 15: 9,361,885 V249A probably damaging Het
Vmn1r128 G A 7: 21,349,375 M1I probably null Het
Yars T G 4: 129,209,749 L297R probably damaging Het
Zkscan3 A G 13: 21,394,533 L176P probably damaging Het
Other mutations in Cramp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1l APN 17 24983951 missense probably benign 0.11
IGL01360:Cramp1l APN 17 24997573 missense probably damaging 1.00
IGL01966:Cramp1l APN 17 24982943 missense probably benign 0.01
IGL02211:Cramp1l APN 17 24977636 missense possibly damaging 0.94
IGL02474:Cramp1l APN 17 24985050 missense probably damaging 0.98
IGL02798:Cramp1l APN 17 24968920 splice site probably benign
IGL03340:Cramp1l APN 17 24973542 missense probably damaging 1.00
R0106:Cramp1l UTSW 17 24972376 missense probably benign 0.30
R1054:Cramp1l UTSW 17 24983177 missense probably damaging 1.00
R1220:Cramp1l UTSW 17 24982237 missense probably damaging 1.00
R1341:Cramp1l UTSW 17 24977540 missense probably damaging 1.00
R1491:Cramp1l UTSW 17 24972349 missense probably benign 0.17
R1610:Cramp1l UTSW 17 24983951 missense probably benign 0.11
R1649:Cramp1l UTSW 17 24983243 missense probably damaging 1.00
R1795:Cramp1l UTSW 17 24964910 missense probably damaging 1.00
R1856:Cramp1l UTSW 17 24968978 missense probably damaging 1.00
R1881:Cramp1l UTSW 17 24977682 splice site probably benign
R1968:Cramp1l UTSW 17 24964939 missense probably damaging 1.00
R2047:Cramp1l UTSW 17 25003215 nonsense probably null
R2099:Cramp1l UTSW 17 24973085 missense probably benign 0.01
R2298:Cramp1l UTSW 17 24997480 missense probably damaging 0.96
R3752:Cramp1l UTSW 17 24971558 missense probably damaging 1.00
R3821:Cramp1l UTSW 17 24974782 missense probably damaging 1.00
R3861:Cramp1l UTSW 17 24997614 splice site probably benign
R4399:Cramp1l UTSW 17 24979585 missense probably damaging 1.00
R4847:Cramp1l UTSW 17 24985089 missense probably damaging 1.00
R4883:Cramp1l UTSW 17 24982319 missense probably benign
R5579:Cramp1l UTSW 17 24973113 missense possibly damaging 0.89
R5716:Cramp1l UTSW 17 24974735 missense probably damaging 0.99
R6589:Cramp1l UTSW 17 24977492 splice site probably null
R6631:Cramp1l UTSW 17 24983957 missense probably benign 0.40
R7307:Cramp1l UTSW 17 24974745 missense possibly damaging 0.94
R7323:Cramp1l UTSW 17 24982405 missense possibly damaging 0.90
R7672:Cramp1l UTSW 17 24982466 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAGATGTCTACTCACAGGAGAAG -3'
(R):5'- TAAACAGCACATGCCCCTTG -3'

Sequencing Primer
(F):5'- TGTCTACTCACAGGAGAAGGTTAAAC -3'
(R):5'- AGCACATGCCCCTTGGTTAG -3'
Posted On2016-11-08