Incidental Mutation 'P4717OSA:Prss12'
ID43989
Institutional Source Beutler Lab
Gene Symbol Prss12
Ensembl Gene ENSMUSG00000027978
Gene Nameprotease, serine 12 neurotrypsin (motopsin)
Synonymsmotopsin, Bssp-3
Accession Numbers

Genbank: NM_008939.2

Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated
Chromosome3
Chromosomal Location123446913-123506597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123447618 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 154 (Y154H)
Ref Sequence ENSEMBL: ENSMUSP00000029603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029603]
Predicted Effect probably damaging
Transcript: ENSMUST00000029603
AA Change: Y154H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029603
Gene: ENSMUSG00000027978
AA Change: Y154H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 43 N/A INTRINSIC
low complexity region 45 64 N/A INTRINSIC
KR 83 159 2.07e-21 SMART
SR 166 266 4.68e-57 SMART
SR 273 372 9.67e-50 SMART
SR 386 486 3.55e-57 SMART
Tryp_SPc 516 755 6.38e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199206
Meta Mutation Damage Score 0.2587 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. Studies in mouse suggest that the encoded enzyme may be involved in structural reorganizations associated with learning and memory. The enzyme is also expressed in Leydig cells in the testis, but its function in this tissue is unknown. Defects in this gene are a cause of mental retardation autosomal recessive type 1 (MRT1). [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display hypoactivity and increased anxiety. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Prss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prss12 APN 3 123486949 splice site probably benign
IGL01090:Prss12 APN 3 123482739 missense possibly damaging 0.85
IGL01609:Prss12 APN 3 123482834 missense probably damaging 1.00
IGL02406:Prss12 APN 3 123505474 missense possibly damaging 0.81
IGL02445:Prss12 APN 3 123487020 missense probably damaging 1.00
IGL02928:Prss12 APN 3 123487156 missense possibly damaging 0.51
IGL02970:Prss12 APN 3 123482762 missense probably benign 0.03
IGL03116:Prss12 APN 3 123506276 missense probably benign
IGL03149:Prss12 APN 3 123505387 missense probably benign 0.00
nerd UTSW 3 123447384 missense probably benign 0.31
twerp UTSW 3 123482774 missense probably damaging 1.00
F5426:Prss12 UTSW 3 123506472 missense probably damaging 1.00
PIT4576001:Prss12 UTSW 3 123487115 missense probably damaging 1.00
R0116:Prss12 UTSW 3 123482774 missense probably damaging 1.00
R0528:Prss12 UTSW 3 123482796 missense probably benign 0.00
R0762:Prss12 UTSW 3 123485504 missense probably damaging 1.00
R1051:Prss12 UTSW 3 123485525 missense probably null 0.99
R1916:Prss12 UTSW 3 123506495 missense probably benign 0.07
R2185:Prss12 UTSW 3 123487144 missense probably benign 0.01
R2389:Prss12 UTSW 3 123487021 missense possibly damaging 0.63
R2938:Prss12 UTSW 3 123486976 missense probably benign 0.00
R3118:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R3119:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R4080:Prss12 UTSW 3 123485485 missense probably benign 0.44
R4161:Prss12 UTSW 3 123485527 nonsense probably null
R4997:Prss12 UTSW 3 123447208 missense probably benign 0.01
R5291:Prss12 UTSW 3 123505463 missense probably damaging 0.98
R5597:Prss12 UTSW 3 123464740 missense probably benign 0.18
R5941:Prss12 UTSW 3 123505501 missense probably benign 0.01
R6005:Prss12 UTSW 3 123482768 missense probably benign 0.00
R6119:Prss12 UTSW 3 123489609 missense possibly damaging 0.64
R6430:Prss12 UTSW 3 123479594 missense probably damaging 1.00
R6492:Prss12 UTSW 3 123447399 missense probably benign
R6864:Prss12 UTSW 3 123447384 missense probably benign 0.31
R7334:Prss12 UTSW 3 123487131 missense probably benign
R7492:Prss12 UTSW 3 123482776 nonsense probably null
R7669:Prss12 UTSW 3 123447396 missense probably benign
R7898:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
R8206:Prss12 UTSW 3 123464962 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTCTACACTGGGACGAGGTGC -3'
(R):5'- GGCAGCGAGACAAACATTTCACAG -3'

Sequencing Primer
(F):5'- ACAACTTCTGCCGGAGC -3'
(R):5'- Tcacacacacacacacacac -3'
Posted On2013-05-31