Incidental Mutation 'P4717OSA:Gbp2'
ID43990
Institutional Source Beutler Lab
Gene Symbol Gbp2
Ensembl Gene ENSMUSG00000028270
Gene Nameguanylate binding protein 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location142620602-142638008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142630596 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 236 (F236L)
Ref Sequence ENSEMBL: ENSMUSP00000132435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165774] [ENSMUST00000169572]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165774
AA Change: F236L

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132435
Gene: ENSMUSG00000028270
AA Change: F236L

DomainStartEndE-ValueType
Pfam:GBP 18 280 7.5e-124 PFAM
Pfam:GBP_C 282 578 1.3e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169572
SMART Domains Protein: ENSMUSP00000129039
Gene: ENSMUSG00000028270

DomainStartEndE-ValueType
Pfam:GBP 18 115 3.1e-49 PFAM
Pfam:MMR_HSR1 40 116 1.3e-6 PFAM
Meta Mutation Damage Score 0.4092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to increased susceptibility to chronic Toxoplasma gondii infection, characterized by an increased parasite burden in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Gbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gbp2 APN 3 142633480 missense probably damaging 1.00
IGL02055:Gbp2 APN 3 142632230 missense probably benign 0.16
IGL03024:Gbp2 APN 3 142632019 missense probably damaging 1.00
PIT4445001:Gbp2 UTSW 3 142637466 missense probably benign
R0267:Gbp2 UTSW 3 142630106 missense probably benign 0.00
R0507:Gbp2 UTSW 3 142630033 missense probably damaging 1.00
R0601:Gbp2 UTSW 3 142630758 missense possibly damaging 0.47
R1005:Gbp2 UTSW 3 142630501 splice site probably benign
R1006:Gbp2 UTSW 3 142637422 missense probably damaging 1.00
R1795:Gbp2 UTSW 3 142630523 missense possibly damaging 0.61
R1893:Gbp2 UTSW 3 142630172 splice site probably benign
R2398:Gbp2 UTSW 3 142633362 missense probably benign 0.01
R3978:Gbp2 UTSW 3 142629986 missense possibly damaging 0.88
R4095:Gbp2 UTSW 3 142637449 missense probably benign
R4490:Gbp2 UTSW 3 142623764 missense probably benign 0.30
R5799:Gbp2 UTSW 3 142632082 missense probably benign
R5834:Gbp2 UTSW 3 142633377 missense probably damaging 0.98
R6159:Gbp2 UTSW 3 142632257 missense probably damaging 0.99
R6237:Gbp2 UTSW 3 142632032 missense probably benign
R6494:Gbp2 UTSW 3 142632008 missense probably damaging 0.98
R6982:Gbp2 UTSW 3 142630085 missense probably damaging 1.00
R7190:Gbp2 UTSW 3 142633447 missense probably benign 0.15
R8292:Gbp2 UTSW 3 142623823 missense probably damaging 1.00
Z1088:Gbp2 UTSW 3 142630015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCTGGAACATTCCCTGACCCTG -3'
(R):5'- GCCCATTGACTATGATGCCACCAC -3'

Sequencing Primer
(F):5'- GCTTAGCAGAATCACTTGGACTC -3'
(R):5'- TGCCACCACACAGAGTCTTG -3'
Posted On2013-05-31