Incidental Mutation 'R5632:Secisbp2l'
ID439900
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5632 (G1)
Quality Score212
Status Not validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125740737 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 933 (G933D)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053699
AA Change: G933D

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G933D

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139944
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Arhgef40 C A 14: 51,994,338 T727K probably damaging Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cpeb4 A G 11: 31,889,877 D53G probably damaging Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
H2-DMa A G 17: 34,138,001 T158A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Hif3a T C 7: 17,050,655 I222V possibly damaging Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Tnfrsf8 A T 4: 145,292,633 S211T possibly damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1415:Secisbp2l UTSW 2 125740365 missense probably benign 0.00
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3815:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3816:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4097:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4741:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7287:Secisbp2l UTSW 2 125740369 missense probably benign
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
R7484:Secisbp2l UTSW 2 125771532 nonsense probably null
R7504:Secisbp2l UTSW 2 125758171 missense probably benign 0.30
R7762:Secisbp2l UTSW 2 125768193 missense probably damaging 1.00
R7769:Secisbp2l UTSW 2 125771545 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCTGTGGGCTCATGAC -3'
(R):5'- GCTTCCTGCTTGTAGAGACTAAC -3'

Sequencing Primer
(F):5'- GCTGTGGGCTCATGACTATAATCC -3'
(R):5'- CCTGCTTGTAGAGACTAACTGGAG -3'
Posted On2016-11-08