Incidental Mutation 'R5632:Tnfrsf8'
ID439909
Institutional Source Beutler Lab
Gene Symbol Tnfrsf8
Ensembl Gene ENSMUSG00000028602
Gene Nametumor necrosis factor receptor superfamily, member 8
SynonymsCD30
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5632 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location145267137-145315164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145292633 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 211 (S211T)
Ref Sequence ENSEMBL: ENSMUSP00000030339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030339
AA Change: S211T

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: S211T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123027
AA Change: S211T

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602
AA Change: S211T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Arhgef40 C A 14: 51,994,338 T727K probably damaging Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cpeb4 A G 11: 31,889,877 D53G probably damaging Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
H2-DMa A G 17: 34,138,001 T158A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Hif3a T C 7: 17,050,655 I222V possibly damaging Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in Tnfrsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tnfrsf8 APN 4 145292591 splice site probably null
IGL02815:Tnfrsf8 APN 4 145298778 missense possibly damaging 0.68
IGL02819:Tnfrsf8 APN 4 145269133 missense probably damaging 1.00
IGL03033:Tnfrsf8 APN 4 145292649 missense possibly damaging 0.86
IGL03105:Tnfrsf8 APN 4 145298784 missense probably damaging 1.00
IGL02837:Tnfrsf8 UTSW 4 145268998 missense probably benign 0.10
R0114:Tnfrsf8 UTSW 4 145288047 missense possibly damaging 0.95
R0326:Tnfrsf8 UTSW 4 145288459 missense possibly damaging 0.64
R0594:Tnfrsf8 UTSW 4 145296861 missense probably damaging 1.00
R0639:Tnfrsf8 UTSW 4 145288027 missense probably benign 0.24
R0826:Tnfrsf8 UTSW 4 145285138 splice site probably benign
R3056:Tnfrsf8 UTSW 4 145285325 critical splice donor site probably null
R4700:Tnfrsf8 UTSW 4 145303122 missense probably damaging 0.99
R4765:Tnfrsf8 UTSW 4 145296877 missense probably benign 0.19
R5149:Tnfrsf8 UTSW 4 145303105 missense possibly damaging 0.53
R5452:Tnfrsf8 UTSW 4 145292644 missense possibly damaging 0.96
R5673:Tnfrsf8 UTSW 4 145285335 missense probably benign 0.14
R5877:Tnfrsf8 UTSW 4 145292687 missense probably benign 0.20
R6243:Tnfrsf8 UTSW 4 145303101 missense possibly damaging 0.61
R6259:Tnfrsf8 UTSW 4 145277524 critical splice donor site probably null
R6326:Tnfrsf8 UTSW 4 145269224 missense probably damaging 1.00
R6603:Tnfrsf8 UTSW 4 145292598 missense possibly damaging 0.70
R7025:Tnfrsf8 UTSW 4 145274403 missense possibly damaging 0.87
R7156:Tnfrsf8 UTSW 4 145315084 start codon destroyed unknown
R7313:Tnfrsf8 UTSW 4 145274382 missense probably benign 0.33
R7505:Tnfrsf8 UTSW 4 145269115 missense probably damaging 1.00
Z1177:Tnfrsf8 UTSW 4 145292709 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAGGACCTTTGGCACTTGAG -3'
(R):5'- AGCCTTTCTCCATAGACACTAATCC -3'

Sequencing Primer
(F):5'- ACTTGAGCCTCAGCCTCAG -3'
(R):5'- TTCTCCATAGACACTAATCCCCAAAC -3'
Posted On2016-11-08