Incidental Mutation 'R5632:Hif3a'
ID439917
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R5632 (G1)
Quality Score221
Status Not validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17050655 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 222 (I222V)
Ref Sequence ENSEMBL: ENSMUSP00000104132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492] [ENSMUST00000153833]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037762
AA Change: I220V

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: I220V

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108492
AA Change: I222V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: I222V

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139224
AA Change: I3V
Predicted Effect probably benign
Transcript: ENSMUST00000153833
SMART Domains Protein: ENSMUSP00000117728
Gene: ENSMUSG00000004328

DomainStartEndE-ValueType
HLH 20 75 1.27e-7 SMART
low complexity region 87 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Arhgef40 C A 14: 51,994,338 T727K probably damaging Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cpeb4 A G 11: 31,889,877 D53G probably damaging Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
H2-DMa A G 17: 34,138,001 T158A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Tnfrsf8 A T 4: 145,292,633 S211T possibly damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1494:Hif3a UTSW 7 17054722 missense probably damaging 1.00
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R1916:Hif3a UTSW 7 17039656 missense possibly damaging 0.87
R2026:Hif3a UTSW 7 17044397 missense possibly damaging 0.81
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R3921:Hif3a UTSW 7 17037172 missense possibly damaging 0.80
R4003:Hif3a UTSW 7 17044919 missense probably damaging 0.99
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7478:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7482:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGATCCCCTCCTTCAGAAG -3'
(R):5'- TGAGACTCAGACACAGCAGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TCAGACACAGCAGGCATCC -3'
Posted On2016-11-08