Incidental Mutation 'P4717OSA:Depdc1a'
ID43992
Institutional Source Beutler Lab
Gene Symbol Depdc1a
Ensembl Gene ENSMUSG00000028175
Gene NameDEP domain containing 1a
Synonyms5830484J08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location159495433-159529955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 159522547 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 312 (V312A)
Ref Sequence ENSEMBL: ENSMUSP00000029825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029825] [ENSMUST00000106041] [ENSMUST00000120272]
Predicted Effect probably damaging
Transcript: ENSMUST00000029825
AA Change: V312A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029825
Gene: ENSMUSG00000028175
AA Change: V312A

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 3e-9 SMART
low complexity region 745 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106041
SMART Domains Protein: ENSMUSP00000101656
Gene: ENSMUSG00000028175

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
Pfam:RhoGAP 251 357 2.3e-11 PFAM
coiled coil region 460 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120272
AA Change: V312A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113216
Gene: ENSMUSG00000028175
AA Change: V312A

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 4e-9 SMART
coiled coil region 737 765 N/A INTRINSIC
Meta Mutation Damage Score 0.1075 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Depdc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Depdc1a APN 3 159522738 nonsense probably null
IGL00581:Depdc1a APN 3 159526552 missense probably benign 0.12
IGL00961:Depdc1a APN 3 159523814 missense possibly damaging 0.79
IGL01530:Depdc1a APN 3 159523923 missense probably damaging 1.00
IGL01567:Depdc1a APN 3 159526546 missense probably damaging 1.00
IGL02320:Depdc1a APN 3 159516933 missense probably damaging 0.99
IGL02622:Depdc1a APN 3 159515510 missense probably benign 0.02
IGL02647:Depdc1a APN 3 159522866 missense probably damaging 1.00
P0033:Depdc1a UTSW 3 159516141 missense probably damaging 0.99
P4748:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
R0220:Depdc1a UTSW 3 159523905 missense probably benign 0.06
R0454:Depdc1a UTSW 3 159516900 splice site probably null
R0479:Depdc1a UTSW 3 159520860 missense probably damaging 1.00
R1317:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R1452:Depdc1a UTSW 3 159526691 missense possibly damaging 0.88
R1567:Depdc1a UTSW 3 159522540 missense possibly damaging 0.86
R1669:Depdc1a UTSW 3 159522924 missense probably benign 0.07
R1751:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R2332:Depdc1a UTSW 3 159523866 missense probably damaging 1.00
R4023:Depdc1a UTSW 3 159516149 splice site probably null
R4254:Depdc1a UTSW 3 159498487 missense probably damaging 0.99
R4551:Depdc1a UTSW 3 159522584 missense probably damaging 1.00
R4780:Depdc1a UTSW 3 159526706 missense probably benign 0.00
R4782:Depdc1a UTSW 3 159526636 missense probably damaging 1.00
R4866:Depdc1a UTSW 3 159516127 missense probably damaging 0.96
R4981:Depdc1a UTSW 3 159523913 missense probably benign 0.14
R5100:Depdc1a UTSW 3 159515520 missense probably benign 0.06
R5326:Depdc1a UTSW 3 159526649 missense probably damaging 1.00
R5367:Depdc1a UTSW 3 159523954 splice site probably null
R5892:Depdc1a UTSW 3 159526669 missense probably damaging 1.00
R6314:Depdc1a UTSW 3 159498414 missense probably damaging 1.00
R6467:Depdc1a UTSW 3 159516042 missense probably benign 0.00
R6674:Depdc1a UTSW 3 159526707 missense probably benign 0.00
R7061:Depdc1a UTSW 3 159522852 missense possibly damaging 0.74
R7366:Depdc1a UTSW 3 159523212 missense probably benign 0.00
R7531:Depdc1a UTSW 3 159522639 missense probably damaging 1.00
R7886:Depdc1a UTSW 3 159516069 missense probably benign 0.04
R7981:Depdc1a UTSW 3 159520851 missense probably benign 0.00
R8335:Depdc1a UTSW 3 159523222 missense probably damaging 1.00
X0026:Depdc1a UTSW 3 159498631 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATGTGTCCTATTGAAATGGCTTCC -3'
(R):5'- TGGCTGCTGAGCATTTTCATCTGAG -3'

Sequencing Primer
(F):5'- TGGCTTCCAAATTAAGCAACTGC -3'
(R):5'- GTGCAGACACTAACGATTGCTTAC -3'
Posted On2013-05-31