Incidental Mutation 'R5632:Cpeb4'
ID439933
Institutional Source Beutler Lab
Gene Symbol Cpeb4
Ensembl Gene ENSMUSG00000020300
Gene Namecytoplasmic polyadenylation element binding protein 4
Synonyms
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R5632 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location31872211-31935634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31889877 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000116753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020543] [ENSMUST00000109412] [ENSMUST00000155278]
Predicted Effect probably damaging
Transcript: ENSMUST00000020543
AA Change: D382G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020543
Gene: ENSMUSG00000020300
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 83 96 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 281 314 N/A INTRINSIC
RRM 473 545 4.3e-5 SMART
RRM 581 654 1.11e-2 SMART
PDB:2M13|A 655 720 3e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000109412
AA Change: D382G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105039
Gene: ENSMUSG00000020300
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 83 96 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 281 314 N/A INTRINSIC
RRM 456 528 4.3e-5 SMART
RRM 564 637 1.11e-2 SMART
PDB:2M13|A 638 703 3e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000155278
AA Change: D53G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116753
Gene: ENSMUSG00000020300
AA Change: D53G

DomainStartEndE-ValueType
RRM 136 208 4.3e-5 SMART
RRM 244 317 1.11e-2 SMART
PDB:2M13|A 318 383 2e-7 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show slightly longer dendritic spines but normal hippocampal synaptic plasticity and memory. Homozygotes for a different null allele show neo- and postnatal lethality, erythropoiesis, suckling and mobility defects, and reduced motor axon branching and NMJ formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Arhgef40 C A 14: 51,994,338 T727K probably damaging Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
H2-DMa A G 17: 34,138,001 T158A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Hif3a T C 7: 17,050,655 I222V possibly damaging Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Tnfrsf8 A T 4: 145,292,633 S211T possibly damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in Cpeb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Cpeb4 APN 11 31873204 missense probably damaging 1.00
IGL02329:Cpeb4 APN 11 31872316 missense possibly damaging 0.94
IGL02396:Cpeb4 APN 11 31925441 missense probably benign 0.38
IGL03304:Cpeb4 APN 11 31872739 missense probably damaging 1.00
FR4304:Cpeb4 UTSW 11 31927638 critical splice acceptor site probably benign
FR4342:Cpeb4 UTSW 11 31927638 critical splice acceptor site probably benign
R1174:Cpeb4 UTSW 11 31920472 missense probably damaging 0.96
R3969:Cpeb4 UTSW 11 31872811 missense possibly damaging 0.95
R4005:Cpeb4 UTSW 11 31925390 missense probably damaging 0.96
R4017:Cpeb4 UTSW 11 31924671 missense probably damaging 1.00
R4539:Cpeb4 UTSW 11 31873206 missense probably damaging 1.00
R4580:Cpeb4 UTSW 11 31927757 critical splice donor site probably null
R4978:Cpeb4 UTSW 11 31931509 missense probably null 0.88
R5809:Cpeb4 UTSW 11 31872801 missense probably damaging 1.00
R6164:Cpeb4 UTSW 11 31920584 critical splice donor site probably null
R6735:Cpeb4 UTSW 11 31924700 missense probably benign 0.19
R6955:Cpeb4 UTSW 11 31908864 missense possibly damaging 0.90
R7312:Cpeb4 UTSW 11 31931417 missense probably damaging 0.98
R7341:Cpeb4 UTSW 11 31918807 missense possibly damaging 0.86
R7382:Cpeb4 UTSW 11 31872828 missense probably damaging 0.97
R7705:Cpeb4 UTSW 11 31872327 missense probably damaging 0.97
R8387:Cpeb4 UTSW 11 31908877 critical splice donor site probably null
RF004:Cpeb4 UTSW 11 31927634 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CGTGCTAGAGTATGTTCTGCTAAATG -3'
(R):5'- TGGTTCTACTGCAGATGCTC -3'

Sequencing Primer
(F):5'- AAATGCAGCTTATTTTCCTCTTGTG -3'
(R):5'- GCAGATGCTCATCAAATAAATATGAC -3'
Posted On2016-11-08