Incidental Mutation 'R5632:Arhgef15'
ID439935
Institutional Source Beutler Lab
Gene Symbol Arhgef15
Ensembl Gene ENSMUSG00000052921
Gene NameRho guanine nucleotide exchange factor (GEF) 15
Synonyms
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5632 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68943155-68957480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68954051 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 240 (P240L)
Ref Sequence ENSEMBL: ENSMUSP00000104311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065040] [ENSMUST00000108671]
Predicted Effect probably benign
Transcript: ENSMUST00000065040
AA Change: P240L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000067684
Gene: ENSMUSG00000052921
AA Change: P240L

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108670
Predicted Effect probably benign
Transcript: ENSMUST00000108671
AA Change: P240L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104311
Gene: ENSMUSG00000052921
AA Change: P240L

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock out allele exhibit increased excitatory synapse formation. Mice homozygous for a knock-out allele exhibit delayed radial growth, sparse vasculature and empty baselment membrane sleeves in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef40 C A 14: 51,994,338 T727K probably damaging Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cpeb4 A G 11: 31,889,877 D53G probably damaging Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
H2-DMa A G 17: 34,138,001 T158A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Hif3a T C 7: 17,050,655 I222V possibly damaging Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Tnfrsf8 A T 4: 145,292,633 S211T possibly damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in Arhgef15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Arhgef15 APN 11 68954102 missense probably damaging 1.00
IGL02382:Arhgef15 APN 11 68954030 missense probably damaging 0.98
R0041:Arhgef15 UTSW 11 68954516 missense possibly damaging 0.92
R0208:Arhgef15 UTSW 11 68946373 missense probably benign 0.09
R0276:Arhgef15 UTSW 11 68953472 splice site probably benign
R0368:Arhgef15 UTSW 11 68954693 missense probably damaging 0.99
R0706:Arhgef15 UTSW 11 68954576 missense probably damaging 1.00
R1628:Arhgef15 UTSW 11 68944814 missense possibly damaging 0.86
R1966:Arhgef15 UTSW 11 68954675 missense probably damaging 1.00
R2105:Arhgef15 UTSW 11 68947681 splice site probably null
R2278:Arhgef15 UTSW 11 68951691 missense probably damaging 1.00
R4667:Arhgef15 UTSW 11 68954561 missense probably benign 0.00
R4836:Arhgef15 UTSW 11 68949925 intron probably benign
R4898:Arhgef15 UTSW 11 68951345 missense probably benign 0.00
R4966:Arhgef15 UTSW 11 68947317 missense probably benign 0.08
R5304:Arhgef15 UTSW 11 68947237 missense probably null 0.32
R5333:Arhgef15 UTSW 11 68947196 intron probably benign
R5546:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5707:Arhgef15 UTSW 11 68954715 missense probably damaging 0.98
R5839:Arhgef15 UTSW 11 68954156 missense probably benign 0.00
R5926:Arhgef15 UTSW 11 68951955 missense possibly damaging 0.76
R6376:Arhgef15 UTSW 11 68954970 missense unknown
R6429:Arhgef15 UTSW 11 68947796 missense probably damaging 1.00
R6526:Arhgef15 UTSW 11 68949994 missense probably damaging 1.00
R6749:Arhgef15 UTSW 11 68954557 missense probably damaging 0.99
R7460:Arhgef15 UTSW 11 68947035 missense probably damaging 1.00
R7529:Arhgef15 UTSW 11 68954022 missense probably damaging 1.00
R7598:Arhgef15 UTSW 11 68946410 missense probably damaging 1.00
R7767:Arhgef15 UTSW 11 68953847 missense probably damaging 0.99
X0067:Arhgef15 UTSW 11 68944830 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAGTTTCAGATCTGGCTG -3'
(R):5'- TATAGATACCCGGGTTTGGTCC -3'

Sequencing Primer
(F):5'- TGTGGAAGCTCCTCAGAGG -3'
(R):5'- CCTTGATGTGGGACGAGGC -3'
Posted On2016-11-08