Incidental Mutation 'R5632:H2-DMa'
ID 439946
Institutional Source Beutler Lab
Gene Symbol H2-DMa
Ensembl Gene ENSMUSG00000037649
Gene Name histocompatibility 2, class II, locus DMa
Synonyms H2-M alpha, H2-Ma, H-2Ma
MMRRC Submission 043283-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R5632 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34135182-34139101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34138001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000037088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042121]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042121
AA Change: T158A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649
AA Change: T158A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173907
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired antigen presenting cell function, poor IgG responses to T-dependent antigens, reduced numbers of mature CD4+ T cells, and increased susceptibility to Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,171,583 F72L possibly damaging Het
Abcd4 T C 12: 84,617,302 T7A probably benign Het
Adam33 T G 2: 131,053,442 D619A probably damaging Het
Aldh3b3 C T 19: 3,968,522 probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Arhgef40 C A 14: 51,994,338 T727K probably damaging Het
Arrdc1 T C 2: 24,927,828 T43A probably benign Het
Bcl2l15 A G 3: 103,836,062 N93S probably benign Het
Cd5l G T 3: 87,366,107 E128* probably null Het
Cep97 T C 16: 55,915,583 D284G probably benign Het
Ckmt1 T A 2: 121,360,592 S162T probably damaging Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cpeb4 A G 11: 31,889,877 D53G probably damaging Het
Crocc2 T A 1: 93,217,853 S1485R probably damaging Het
Dcaf5 G A 12: 80,397,752 A189V probably damaging Het
Duox2 C T 2: 122,281,455 G1355S probably damaging Het
Fam120b C T 17: 15,403,082 P441S probably benign Het
Fbxo41 A G 6: 85,484,504 L74P probably damaging Het
Gm996 T C 2: 25,579,264 T212A probably benign Het
Hcar2 T A 5: 123,864,469 T324S probably benign Het
Hif3a T C 7: 17,050,655 I222V possibly damaging Het
Ighv1-7 A G 12: 114,538,881 probably benign Het
Il20 T C 1: 130,907,428 E151G probably benign Het
Jarid2 A G 13: 44,896,290 E236G probably damaging Het
Knl1 T C 2: 119,070,352 S845P probably damaging Het
Lamc2 T C 1: 153,131,890 Y846C probably damaging Het
Lrp5 A G 19: 3,622,512 V599A probably benign Het
Lrrc8b T A 5: 105,480,297 S170T possibly damaging Het
Mex3d T C 10: 80,382,594 K263R probably damaging Het
Mtor A G 4: 148,469,006 K784E possibly damaging Het
Naip5 C A 13: 100,230,662 probably null Het
Ncor1 T C 11: 62,338,234 T609A possibly damaging Het
Ndufs1 C T 1: 63,150,059 A536T probably benign Het
Neto1 A G 18: 86,498,643 I362V probably benign Het
Nfatc3 T C 8: 106,079,057 L178P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nsd3 C T 8: 25,679,969 T707M probably benign Het
Olfr1013 T C 2: 85,770,269 V156A probably benign Het
Olfr1133 A T 2: 87,645,229 V298E probably damaging Het
Olfr568 A C 7: 102,877,797 S226R probably benign Het
Pcnx T A 12: 81,917,730 S224T probably damaging Het
Peak1 T C 9: 56,257,774 T957A probably damaging Het
Pex7 A T 10: 19,888,737 D153E probably damaging Het
Plscr1 A G 9: 92,266,424 E139G probably damaging Het
Psmb8 T C 17: 34,201,240 Y269H probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sft2d2 T C 1: 165,185,088 T80A probably damaging Het
Slc12a5 A G 2: 164,987,221 I583M possibly damaging Het
Slc23a4 T C 6: 34,957,022 M49V probably benign Het
Smarcb1 G A 10: 75,904,418 Q309* probably null Het
Sphkap A T 1: 83,278,285 V294E probably benign Het
Stoml1 C A 9: 58,253,370 P35Q probably damaging Het
Timm10b G C 7: 105,641,122 R42P probably damaging Het
Tnfrsf8 A T 4: 145,292,633 S211T possibly damaging Het
Ttn T C 2: 76,705,820 T26738A probably damaging Het
Vps13d A T 4: 145,074,882 Y474N probably damaging Het
Wdr81 A T 11: 75,445,906 F1552L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wnt7a A C 6: 91,394,655 Y108* probably null Het
Zfp512b C T 2: 181,585,668 R56K probably benign Het
Other mutations in H2-DMa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:H2-DMa APN 17 34137109 splice site probably null
R0422:H2-DMa UTSW 17 34137947 missense probably damaging 1.00
R0620:H2-DMa UTSW 17 34137960 missense probably damaging 0.96
R1240:H2-DMa UTSW 17 34138406 critical splice acceptor site probably null
R1483:H2-DMa UTSW 17 34135750 missense possibly damaging 0.61
R1656:H2-DMa UTSW 17 34138142 missense possibly damaging 0.92
R1657:H2-DMa UTSW 17 34137399 critical splice donor site probably null
R1696:H2-DMa UTSW 17 34138413 missense probably benign 0.44
R2884:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R2886:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R5024:H2-DMa UTSW 17 34138487 missense possibly damaging 0.77
R5236:H2-DMa UTSW 17 34137939 missense probably damaging 1.00
R6358:H2-DMa UTSW 17 34137984 missense probably damaging 1.00
R6423:H2-DMa UTSW 17 34137196 missense probably benign 0.05
R7033:H2-DMa UTSW 17 34136997 splice site probably null
R7387:H2-DMa UTSW 17 34138127 missense probably damaging 1.00
R8060:H2-DMa UTSW 17 34137285 missense probably benign 0.05
R8504:H2-DMa UTSW 17 34138442 missense probably damaging 1.00
R8813:H2-DMa UTSW 17 34135760 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- ACACAGTGTCCTAGCTGCAG -3'
(R):5'- TCACCCCAATAGGCAATTGC -3'

Sequencing Primer
(F):5'- CAGTTTTTGCCGGGAAGACC -3'
(R):5'- GCAATTGCCGTGTAGCG -3'
Posted On 2016-11-08