Incidental Mutation 'P4717OSA:Relt'
ID43995
Institutional Source Beutler Lab
Gene Symbol Relt
Ensembl Gene ENSMUSG00000008318
Gene NameRELT tumor necrosis factor receptor
SynonymsE430021K24Rik, Tnfrsf19l
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location100845847-100863446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100847581 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 360 (R360C)
Ref Sequence ENSEMBL: ENSMUSP00000008462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008462] [ENSMUST00000136231] [ENSMUST00000139604] [ENSMUST00000155413] [ENSMUST00000156855]
Predicted Effect probably damaging
Transcript: ENSMUST00000008462
AA Change: R360C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008462
Gene: ENSMUSG00000008318
AA Change: R360C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
low complexity region 132 138 N/A INTRINSIC
Pfam:RELT 170 209 1.8e-21 PFAM
coiled coil region 233 255 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 313 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136231
SMART Domains Protein: ENSMUSP00000121443
Gene: ENSMUSG00000008318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139604
SMART Domains Protein: ENSMUSP00000119208
Gene: ENSMUSG00000008318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155413
SMART Domains Protein: ENSMUSP00000118150
Gene: ENSMUSG00000008318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
low complexity region 132 138 N/A INTRINSIC
Pfam:RELT 170 218 1.4e-20 PFAM
low complexity region 285 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156855
SMART Domains Protein: ENSMUSP00000120042
Gene: ENSMUSG00000008318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 58 97 2e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1 (TRAF1). This receptor is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. Two alternatively spliced transcript variants of this gene encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Relt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Relt APN 7 100851698 missense probably damaging 1.00
IGL01958:Relt APN 7 100851143 missense probably benign 0.16
ANU22:Relt UTSW 7 100851698 missense probably damaging 1.00
R0026:Relt UTSW 7 100850221 nonsense probably null
R0384:Relt UTSW 7 100847505 missense probably benign 0.26
R0437:Relt UTSW 7 100848784 unclassified probably benign
R0626:Relt UTSW 7 100848816 missense probably damaging 1.00
R1582:Relt UTSW 7 100851353 critical splice donor site probably null
R1802:Relt UTSW 7 100850194 missense probably damaging 0.98
R5977:Relt UTSW 7 100863148 intron probably benign
R6924:Relt UTSW 7 100847261 missense probably damaging 1.00
R6994:Relt UTSW 7 100853114 splice site probably benign
R7403:Relt UTSW 7 100851448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACTTAGCCGGACCACATAGCG -3'
(R):5'- GGCCAAAAGGGTCATCATTTCCCAG -3'

Sequencing Primer
(F):5'- GACCACATAGCGGTTCTCCTG -3'
(R):5'- TAGACCAAGGGTCTGTCTGTACC -3'
Posted On2013-05-31