Incidental Mutation 'R5633:Idh1'
ID439954
Institutional Source Beutler Lab
Gene Symbol Idh1
Ensembl Gene ENSMUSG00000025950
Gene Nameisocitrate dehydrogenase 1 (NADP+), soluble
SynonymsId-1, Idh-1, IDPc, E030024J03Rik
MMRRC Submission 043284-MU
Accession Numbers

Genbank: NM_001111320, NM_010497 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65158616-65186500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65165136 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 272 (Y272H)
Ref Sequence ENSEMBL: ENSMUSP00000127307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097709] [ENSMUST00000149310] [ENSMUST00000169032] [ENSMUST00000188109] [ENSMUST00000188876]
Predicted Effect probably damaging
Transcript: ENSMUST00000097709
AA Change: Y272H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095316
Gene: ENSMUSG00000025950
AA Change: Y272H

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149310
SMART Domains Protein: ENSMUSP00000117853
Gene: ENSMUSG00000025950

DomainStartEndE-ValueType
Iso_dh 9 143 1.74e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169032
AA Change: Y272H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127307
Gene: ENSMUSG00000025950
AA Change: Y272H

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188109
SMART Domains Protein: ENSMUSP00000140757
Gene: ENSMUSG00000025950

DomainStartEndE-ValueType
Iso_dh 9 202 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188876
SMART Domains Protein: ENSMUSP00000139906
Gene: ENSMUSG00000025950

DomainStartEndE-ValueType
Iso_dh 9 187 2.2e-9 SMART
Meta Mutation Damage Score 0.9571 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Electrophoretic variation has been shown in tissues of liver, kidney, spleen and muscle. Strains C57BL/6, C3H/He carry the a allele; DBA/2 carries the b allele; M.m. castaneus and M.m. molossinus carry the c allele; the d allele is found at low frequencyin M. m. molossinus in Japan. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted, other(3) Gene trapped(11)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Idh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Idh1 APN 1 65166243 missense probably damaging 1.00
IGL00790:Idh1 APN 1 65166122 missense possibly damaging 0.94
IGL00979:Idh1 APN 1 65171149 missense probably damaging 1.00
IGL01397:Idh1 APN 1 65168595 missense possibly damaging 0.62
IGL02226:Idh1 APN 1 65161922 missense probably damaging 1.00
IGL02933:Idh1 APN 1 65161913 missense probably damaging 1.00
B5639:Idh1 UTSW 1 65165098 critical splice donor site probably null
R0310:Idh1 UTSW 1 65161920 missense probably damaging 1.00
R0865:Idh1 UTSW 1 65161156 missense probably benign
R1172:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1173:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1174:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1535:Idh1 UTSW 1 65168538 missense probably damaging 1.00
R1833:Idh1 UTSW 1 65161114 missense probably benign
R2135:Idh1 UTSW 1 65161919 missense probably damaging 1.00
R5434:Idh1 UTSW 1 65175336 missense probably benign 0.00
R5478:Idh1 UTSW 1 65161838 missense probably benign 0.04
R6152:Idh1 UTSW 1 65159530 missense probably damaging 1.00
R6249:Idh1 UTSW 1 65166219 missense probably damaging 1.00
R6252:Idh1 UTSW 1 65168531 missense probably benign
R7238:Idh1 UTSW 1 65166125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTAAGACATTCCCTTGTATGG -3'
(R):5'- GGAGAGTTGCAAATGGTATCTCTG -3'

Sequencing Primer
(F):5'- GGCAGCTCACAACTGTTTATAGC -3'
(R):5'- GTTGCAAATGGTATCTCTGATAAAAC -3'
Posted On2016-11-08