Incidental Mutation 'R5633:Stra6l'
ID439968
Institutional Source Beutler Lab
Gene Symbol Stra6l
Ensembl Gene ENSMUSG00000028327
Gene NameSTRA6-like
SynonymsRbpr2, 1300002K09Rik
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45848664-45887008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45881455 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 439 (I439K)
Ref Sequence ENSEMBL: ENSMUSP00000103412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030011] [ENSMUST00000107782] [ENSMUST00000107783]
Predicted Effect probably benign
Transcript: ENSMUST00000030011
AA Change: I439K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030011
Gene: ENSMUSG00000028327
AA Change: I439K

DomainStartEndE-ValueType
Pfam:RBP_receptor 13 602 8.7e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107782
AA Change: I348K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103411
Gene: ENSMUSG00000028327
AA Change: I348K

DomainStartEndE-ValueType
Pfam:RBP_receptor 1 512 2.8e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107783
AA Change: I439K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103412
Gene: ENSMUSG00000028327
AA Change: I439K

DomainStartEndE-ValueType
Pfam:RBP_receptor 12 603 1e-254 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165478
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Stra6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Stra6l APN 4 45864864 splice site probably null
IGL02343:Stra6l APN 4 45869588 missense probably damaging 0.99
IGL02710:Stra6l APN 4 45882728 missense possibly damaging 0.72
IGL02880:Stra6l APN 4 45885278 missense possibly damaging 0.70
IGL03034:Stra6l APN 4 45885392 missense probably benign 0.41
IGL03163:Stra6l APN 4 45881455 missense probably benign 0.03
IGL03355:Stra6l APN 4 45873689 missense probably benign 0.16
K2124:Stra6l UTSW 4 45870770 splice site probably benign
R0800:Stra6l UTSW 4 45882797 missense probably benign 0.29
R1171:Stra6l UTSW 4 45864982 missense probably benign
R1931:Stra6l UTSW 4 45882698 nonsense probably null
R1982:Stra6l UTSW 4 45867237 nonsense probably null
R2331:Stra6l UTSW 4 45858224 critical splice donor site probably null
R4691:Stra6l UTSW 4 45882851 missense probably benign 0.39
R4846:Stra6l UTSW 4 45873682 missense possibly damaging 0.76
R5175:Stra6l UTSW 4 45870860 missense probably benign 0.01
R6212:Stra6l UTSW 4 45884664 missense probably benign
R6517:Stra6l UTSW 4 45879473 missense probably benign
R6534:Stra6l UTSW 4 45860041 splice site probably null
R6584:Stra6l UTSW 4 45869635 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGGGAATCACAGCTCAGAG -3'
(R):5'- TCAGAGCACTCCAGAGACTG -3'

Sequencing Primer
(F):5'- GCTCAGAGCTTGTTCTACTGTTC -3'
(R):5'- CAGAGACTGCCCATCAATAGGTAG -3'
Posted On2016-11-08