Incidental Mutation 'P4717OSA:Glb1l2'
ID43997
Institutional Source Beutler Lab
Gene Symbol Glb1l2
Ensembl Gene ENSMUSG00000036395
Gene Namegalactosidase, beta 1-like 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location26763044-26806468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26766021 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 527 (I527T)
Ref Sequence ENSEMBL: ENSMUSP00000124415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040398] [ENSMUST00000066560] [ENSMUST00000159799] [ENSMUST00000160899] [ENSMUST00000161115] [ENSMUST00000161431] [ENSMUST00000162252] [ENSMUST00000162702]
Predicted Effect probably damaging
Transcript: ENSMUST00000040398
AA Change: I536T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047128
Gene: ENSMUSG00000036395
AA Change: I536T

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_hydro_35 52 384 6.6e-118 PFAM
Pfam:Glyco_hydro_42 84 243 6.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066560
AA Change: I520T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066770
Gene: ENSMUSG00000036395
AA Change: I520T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Glyco_hydro_35 53 368 6.3e-121 PFAM
Pfam:Glyco_hydro_42 68 227 6.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159527
SMART Domains Protein: ENSMUSP00000125401
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
Pfam:Glyco_transf_43 48 259 2.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159799
SMART Domains Protein: ENSMUSP00000124438
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 329 6.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160458
Predicted Effect probably benign
Transcript: ENSMUST00000160899
SMART Domains Protein: ENSMUSP00000124067
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 328 1.7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161115
SMART Domains Protein: ENSMUSP00000125700
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_43 105 316 3.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161431
SMART Domains Protein: ENSMUSP00000124752
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_43 105 202 1.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162252
AA Change: I527T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124415
Gene: ENSMUSG00000036395
AA Change: I527T

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
Pfam:Glyco_hydro_35 60 375 5.3e-121 PFAM
Pfam:Glyco_hydro_42 75 234 5.4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162702
AA Change: I399T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125022
Gene: ENSMUSG00000036395
AA Change: I399T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 27 247 1.4e-67 PFAM
Meta Mutation Damage Score 0.6612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show decreased mean white blood cell and lymphocyte counts and a decreased mean percentage of natural killer cells. Male mutant mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Glb1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Glb1l2 APN 9 26768418 critical splice donor site probably null
IGL02045:Glb1l2 APN 9 26796545 missense probably benign 0.00
IGL02172:Glb1l2 APN 9 26769086 missense probably damaging 0.98
IGL02372:Glb1l2 APN 9 26796476 missense probably damaging 1.00
IGL02831:Glb1l2 APN 9 26767450 missense probably benign 0.00
IGL03057:Glb1l2 APN 9 26806290 splice site probably benign
IGL03101:Glb1l2 APN 9 26765125 missense probably damaging 1.00
IGL03348:Glb1l2 APN 9 26765680 missense probably benign
PIT4362001:Glb1l2 UTSW 9 26773981 missense probably benign 0.05
R0219:Glb1l2 UTSW 9 26806322 missense probably benign 0.33
R0414:Glb1l2 UTSW 9 26765104 nonsense probably null
R0418:Glb1l2 UTSW 9 26794101 missense probably damaging 1.00
R0791:Glb1l2 UTSW 9 26769751 missense possibly damaging 0.96
R1165:Glb1l2 UTSW 9 26794101 missense probably damaging 1.00
R1514:Glb1l2 UTSW 9 26769124 splice site probably benign
R1589:Glb1l2 UTSW 9 26769038 nonsense probably null
R1926:Glb1l2 UTSW 9 26771066 missense probably damaging 0.96
R2928:Glb1l2 UTSW 9 26768426 missense probably benign 0.10
R3441:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R3442:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R3706:Glb1l2 UTSW 9 26771020 splice site probably benign
R3814:Glb1l2 UTSW 9 26771034 missense probably benign 0.00
R5079:Glb1l2 UTSW 9 26771109 missense probably benign
R5308:Glb1l2 UTSW 9 26764759 missense probably damaging 1.00
R5310:Glb1l2 UTSW 9 26796866 intron probably benign
R5746:Glb1l2 UTSW 9 26796790 missense probably benign 0.01
R5969:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R5998:Glb1l2 UTSW 9 26766003 missense possibly damaging 0.68
R6249:Glb1l2 UTSW 9 26765554 intron probably benign
R6284:Glb1l2 UTSW 9 26767448 missense probably benign 0.01
R6469:Glb1l2 UTSW 9 26796532 missense probably benign 0.03
R7054:Glb1l2 UTSW 9 26765127 missense probably null 0.51
R7916:Glb1l2 UTSW 9 26767424 missense probably benign 0.05
R7921:Glb1l2 UTSW 9 26773968 splice site probably null
R8103:Glb1l2 UTSW 9 26765684 missense probably benign
R8354:Glb1l2 UTSW 9 26806417 start gained probably benign
R8454:Glb1l2 UTSW 9 26806417 start gained probably benign
X0020:Glb1l2 UTSW 9 26767733 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATGGGTTCCAATGCTGCTCCTAC -3'
(R):5'- CACACTGATGTCTCAGCTCTGTCAC -3'

Sequencing Primer
(F):5'- CACCTcactgtggcctctg -3'
(R):5'- TATGAGCTTGACATCATCCAGGAG -3'
Posted On2013-05-31