Incidental Mutation 'R5633:Ica1'
ID439975
Institutional Source Beutler Lab
Gene Symbol Ica1
Ensembl Gene ENSMUSG00000062995
Gene Nameislet cell autoantigen 1
SynonymsICA69, 69kDa
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location8630527-8778488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8667257 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 303 (I303N)
Ref Sequence ENSEMBL: ENSMUSP00000111180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038403] [ENSMUST00000115518] [ENSMUST00000115519] [ENSMUST00000115520] [ENSMUST00000126430] [ENSMUST00000153390] [ENSMUST00000156695]
Predicted Effect probably benign
Transcript: ENSMUST00000038403
SMART Domains Protein: ENSMUSP00000040062
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115518
AA Change: I303N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111180
Gene: ENSMUSG00000062995
AA Change: I303N

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115519
SMART Domains Protein: ENSMUSP00000111181
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 465 4.01e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115520
SMART Domains Protein: ENSMUSP00000111182
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126430
SMART Domains Protein: ENSMUSP00000116861
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 1 83 3.3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127398
SMART Domains Protein: ENSMUSP00000118194
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Blast:Arfaptin 7 40 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153390
SMART Domains Protein: ENSMUSP00000117734
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156695
SMART Domains Protein: ENSMUSP00000138459
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Pfam:ICA69 260 301 4.1e-12 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in diabetes and spontaneous lethality at 4-5 months of age on a NOD background, however mice on a 129/Sv background are normal. Onset of diabetes starts 4 weeks later than wild-type NOD mice and mutants are resistant to cyclophospamide-accelerated diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Ica1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ica1 APN 6 8653514 missense probably benign
IGL02248:Ica1 APN 6 8758387 utr 5 prime probably benign
IGL02547:Ica1 APN 6 8670691 splice site probably null
round_heels UTSW 6 8630799 critical splice acceptor site probably null
R0099:Ica1 UTSW 6 8749778 splice site probably benign
R0244:Ica1 UTSW 6 8653632 nonsense probably null
R0479:Ica1 UTSW 6 8754627 missense probably damaging 1.00
R0479:Ica1 UTSW 6 8754683 missense probably damaging 1.00
R0628:Ica1 UTSW 6 8644256 splice site probably benign
R0826:Ica1 UTSW 6 8667375 intron probably benign
R1186:Ica1 UTSW 6 8672326 missense probably damaging 1.00
R1384:Ica1 UTSW 6 8742262 nonsense probably null
R1957:Ica1 UTSW 6 8749736 missense possibly damaging 0.85
R2431:Ica1 UTSW 6 8658265 missense probably benign
R3722:Ica1 UTSW 6 8659021 intron probably benign
R4224:Ica1 UTSW 6 8659960 missense probably benign 0.11
R4777:Ica1 UTSW 6 8644145 missense probably benign
R5786:Ica1 UTSW 6 8672391 missense possibly damaging 0.50
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6053:Ica1 UTSW 6 8630783 missense probably benign 0.01
R6221:Ica1 UTSW 6 8644181 missense possibly damaging 0.82
R6794:Ica1 UTSW 6 8653659 missense probably benign 0.00
R6819:Ica1 UTSW 6 8742288 missense probably damaging 0.99
R7201:Ica1 UTSW 6 8644015 missense probably damaging 1.00
R7574:Ica1 UTSW 6 8658266 missense probably benign 0.00
R7841:Ica1 UTSW 6 8737072 missense probably damaging 1.00
R7924:Ica1 UTSW 6 8737072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGTAAACTCGGTCAGCC -3'
(R):5'- TAGGAGAGAAGTGCCTGTCTTAAG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- AGAAGTGCCTGTCTTAAGTTTTCAGC -3'
Posted On2016-11-08