Incidental Mutation 'R5633:Syt9'
ID439978
Institutional Source Beutler Lab
Gene Symbol Syt9
Ensembl Gene ENSMUSG00000062542
Gene Namesynaptotagmin IX
SynonymsSytv
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107370728-107548656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107425296 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 132 (T132I)
Ref Sequence ENSEMBL: ENSMUSP00000122049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073459] [ENSMUST00000130414] [ENSMUST00000137663]
Predicted Effect probably damaging
Transcript: ENSMUST00000073459
AA Change: T132I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073164
Gene: ENSMUSG00000062542
AA Change: T132I

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 7e-54 BLAST
C2 236 339 1.8e-26 SMART
C2 368 482 1.6e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130414
AA Change: T132I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122049
Gene: ENSMUSG00000062542
AA Change: T132I

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 3e-57 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137663
SMART Domains Protein: ENSMUSP00000117969
Gene: ENSMUSG00000062542

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit 50% embryonic lethality while cre-mediated removal of a conditional allele impairs inhibitions of postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
Olfr773 A T 10: 129,186,849 F191I probably benign Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Syt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Syt9 APN 7 107425367 nonsense probably null
IGL00541:Syt9 APN 7 107502180 missense probably null 1.00
IGL01161:Syt9 APN 7 107425149 missense probably damaging 0.97
IGL01705:Syt9 APN 7 107436352 missense probably damaging 0.96
IGL02567:Syt9 APN 7 107436661 missense probably damaging 1.00
IGL03268:Syt9 APN 7 107436405 missense probably benign 0.01
R0684:Syt9 UTSW 7 107425136 missense probably damaging 1.00
R0743:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R0835:Syt9 UTSW 7 107506530 missense probably benign 0.30
R0884:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R1114:Syt9 UTSW 7 107425355 missense possibly damaging 0.93
R1502:Syt9 UTSW 7 107436487 missense probably damaging 1.00
R1885:Syt9 UTSW 7 107436529 missense probably damaging 1.00
R1962:Syt9 UTSW 7 107425107 missense probably damaging 1.00
R2368:Syt9 UTSW 7 107436699 missense probably damaging 1.00
R2421:Syt9 UTSW 7 107436781 missense probably benign 0.39
R4134:Syt9 UTSW 7 107436423 missense probably benign 0.22
R4477:Syt9 UTSW 7 107425221 missense probably damaging 1.00
R4602:Syt9 UTSW 7 107436387 nonsense probably null
R4685:Syt9 UTSW 7 107436471 missense possibly damaging 0.89
R4977:Syt9 UTSW 7 107504272 missense probably damaging 1.00
R5141:Syt9 UTSW 7 107504219 missense probably damaging 1.00
R5421:Syt9 UTSW 7 107425356 missense probably benign 0.00
R5440:Syt9 UTSW 7 107502123 missense possibly damaging 0.46
R5978:Syt9 UTSW 7 107436413 missense probably benign 0.02
R6260:Syt9 UTSW 7 107436510 missense possibly damaging 0.93
R6733:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R6889:Syt9 UTSW 7 107425286 missense probably damaging 0.99
X0018:Syt9 UTSW 7 107506574 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AAACTGTGCTGGGTTCCGTG -3'
(R):5'- TAGGTCCACAGAGTTTCCCC -3'

Sequencing Primer
(F):5'- CTGGGTTCCGTGGCGAGAG -3'
(R):5'- GGCATCTAGATTCTCAGCTAGTCAG -3'
Posted On2016-11-08