Incidental Mutation 'P4717OSA:Nxpe2'
ID43998
Institutional Source Beutler Lab
Gene Symbol Nxpe2
Ensembl Gene ENSMUSG00000032028
Gene Nameneurexophilin and PC-esterase domain family, member 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location48318006-48353454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48326377 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 193 (M193L)
Ref Sequence ENSEMBL: ENSMUSP00000034527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034527] [ENSMUST00000135457] [ENSMUST00000137976] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect probably benign
Transcript: ENSMUST00000034527
AA Change: M193L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034527
Gene: ENSMUSG00000032028
AA Change: M193L

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 80 277 1.2e-18 PFAM
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135457
Predicted Effect probably benign
Transcript: ENSMUST00000137976
SMART Domains Protein: ENSMUSP00000116684
Gene: ENSMUSG00000032028

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 99 187 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149185
Predicted Effect probably benign
Transcript: ENSMUST00000215780
Predicted Effect probably benign
Transcript: ENSMUST00000216998
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Nxpe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Nxpe2 APN 9 48320623 missense probably benign 0.00
IGL01830:Nxpe2 APN 9 48326494 missense probably damaging 1.00
IGL02039:Nxpe2 APN 9 48319659 missense probably benign 0.11
IGL02618:Nxpe2 APN 9 48326334 missense probably damaging 1.00
IGL03065:Nxpe2 APN 9 48319692 missense possibly damaging 0.68
IGL03128:Nxpe2 APN 9 48319498 missense probably benign 0.12
R0019:Nxpe2 UTSW 9 48319780 missense probably benign 0.37
R0172:Nxpe2 UTSW 9 48319909 missense possibly damaging 0.76
R0255:Nxpe2 UTSW 9 48340570 critical splice donor site probably null
R0415:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1061:Nxpe2 UTSW 9 48326363 missense probably damaging 1.00
R1248:Nxpe2 UTSW 9 48319911 missense possibly damaging 0.46
R1311:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1393:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1827:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1828:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1831:Nxpe2 UTSW 9 48326152 missense probably benign 0.01
R1866:Nxpe2 UTSW 9 48326821 missense probably benign 0.01
R1889:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1892:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1903:Nxpe2 UTSW 9 48319606 missense probably benign 0.40
R1928:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1959:Nxpe2 UTSW 9 48319726 missense probably benign 0.06
R4594:Nxpe2 UTSW 9 48319482 missense probably damaging 1.00
R4697:Nxpe2 UTSW 9 48320521 missense probably benign 0.03
R4909:Nxpe2 UTSW 9 48319597 missense possibly damaging 0.93
R5048:Nxpe2 UTSW 9 48326088 splice site probably null
R5372:Nxpe2 UTSW 9 48339519 missense possibly damaging 0.66
R5614:Nxpe2 UTSW 9 48323101 missense probably benign 0.30
R5762:Nxpe2 UTSW 9 48319575 missense probably benign 0.02
R6151:Nxpe2 UTSW 9 48326191 missense probably benign 0.01
R6958:Nxpe2 UTSW 9 48326266 missense probably damaging 1.00
R7130:Nxpe2 UTSW 9 48339537 missense probably benign 0.00
R7138:Nxpe2 UTSW 9 48320706 missense probably damaging 1.00
R7250:Nxpe2 UTSW 9 48326796 missense possibly damaging 0.77
R7289:Nxpe2 UTSW 9 48323039 critical splice donor site probably null
R7949:Nxpe2 UTSW 9 48323097 missense possibly damaging 0.83
R7973:Nxpe2 UTSW 9 48319868 missense probably damaging 0.99
R8327:Nxpe2 UTSW 9 48319759 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATATTGACACAGCTCCGCACTTG -3'
(R):5'- GCAGTCACAGCAATCCTGGAGAAG -3'

Sequencing Primer
(F):5'- CTCCGCACTTGTGTTTAAGG -3'
(R):5'- GCAATCCTGGAGAAGCTAAAC -3'
Posted On2013-05-31