Incidental Mutation 'R5633:Olfr773'
ID439985
Institutional Source Beutler Lab
Gene Symbol Olfr773
Ensembl Gene ENSMUSG00000096000
Gene Nameolfactory receptor 773
SynonymsMOR114-15, GA_x6K02T2PULF-10872859-10871923, Olfr773-ps1
MMRRC Submission 043284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5633 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129186484-129187419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129186849 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 191 (F191I)
Ref Sequence ENSEMBL: ENSMUSP00000072743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072976]
Predicted Effect probably benign
Transcript: ENSMUST00000072976
AA Change: F191I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000072743
Gene: ENSMUSG00000096000
AA Change: F191I

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.6e-48 PFAM
Pfam:7tm_1 38 287 4.4e-22 PFAM
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T A 4: 144,618,028 C125S probably benign Het
Abcb8 T C 5: 24,403,109 L382P probably damaging Het
Acot3 A G 12: 84,058,950 probably null Het
Acsl6 A T 11: 54,337,189 Q345L probably benign Het
Adcy8 A G 15: 64,699,285 S1170P probably damaging Het
Ankrd28 T G 14: 31,735,065 D182A probably damaging Het
B3galt5 A T 16: 96,315,509 H114L probably benign Het
BC053393 C T 11: 46,574,606 S9L unknown Het
Bcas2 T A 3: 103,178,424 Y207* probably null Het
Best1 A G 19: 9,992,103 L197P probably benign Het
Chil6 C A 3: 106,388,752 C389F probably damaging Het
Chrna4 T C 2: 181,029,460 T168A probably damaging Het
Ckmt1 C G 2: 121,363,629 probably benign Het
Dhcr7 T C 7: 143,847,423 L441P probably damaging Het
Dmtn T C 14: 70,604,979 M365V probably benign Het
Dmxl1 T A 18: 49,877,697 S974T probably damaging Het
Dnajb13 T C 7: 100,507,419 D150G probably benign Het
Eef2k C A 7: 120,873,290 probably benign Het
Elp2 T A 18: 24,615,210 V213E probably damaging Het
Fbxo43 A T 15: 36,162,095 probably null Het
Gm11559 C A 11: 99,864,586 C20* probably null Het
Gnb2 T C 5: 137,529,192 I213V probably benign Het
Gnb5 C T 9: 75,344,514 T306I probably damaging Het
Ica1 A T 6: 8,667,257 I303N possibly damaging Het
Idh1 A G 1: 65,165,136 Y272H probably damaging Het
Ikzf2 G A 1: 69,539,097 Q273* probably null Het
Itpkb A T 1: 180,327,225 probably benign Het
Kntc1 C T 5: 123,819,057 T2143I probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lmbrd1 C A 1: 24,748,862 D464E possibly damaging Het
Med13 A G 11: 86,278,931 probably benign Het
Mn1 T C 5: 111,420,326 F721L possibly damaging Het
Myo9a T A 9: 59,868,184 L1026Q possibly damaging Het
P4htm A C 9: 108,579,723 D428E probably damaging Het
Parp8 C T 13: 116,876,580 R602H probably damaging Het
Pkd2 T A 5: 104,498,506 S726R probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Psmd5 A G 2: 34,856,488 I359T probably benign Het
Rassf6 T C 5: 90,604,118 H292R possibly damaging Het
Rnf145 T C 11: 44,560,088 I413T probably damaging Het
Rpn2 T A 2: 157,283,596 V9D possibly damaging Het
Rpp30 T C 19: 36,086,990 L57P probably damaging Het
Slc41a1 A G 1: 131,846,587 H464R possibly damaging Het
Slc47a1 G T 11: 61,369,261 P163Q probably damaging Het
Smc4 T A 3: 69,008,110 I165K probably damaging Het
Stra6l T A 4: 45,881,455 I439K probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Trpm2 T C 10: 77,938,353 I471V possibly damaging Het
Uap1l1 A G 2: 25,363,349 M358T probably benign Het
Vmn1r91 A T 7: 20,101,945 H263L possibly damaging Het
Zfp407 T C 18: 84,561,044 D648G probably benign Het
Zpbp2 T C 11: 98,554,758 I150T probably damaging Het
Other mutations in Olfr773
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Olfr773 APN 10 129186935 missense probably benign 0.04
R1924:Olfr773 UTSW 10 129187175 missense possibly damaging 0.78
R4171:Olfr773 UTSW 10 129186584 missense probably benign 0.39
R4688:Olfr773 UTSW 10 129186645 missense probably damaging 0.99
R4952:Olfr773 UTSW 10 129186597 missense probably benign 0.12
R5066:Olfr773 UTSW 10 129186564 missense possibly damaging 0.88
R5610:Olfr773 UTSW 10 129186557 missense probably damaging 0.96
R6953:Olfr773 UTSW 10 129186605 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTTGATGGCCACCTCATC -3'
(R):5'- TGAGTACCACAGTCTGCAGAAG -3'

Sequencing Primer
(F):5'- TGCAGCTGCCATAGGTAATG -3'
(R):5'- CTGCAGAAGACTTGTGTTTTGTTC -3'
Posted On2016-11-08