Incidental Mutation 'P4717OSA:4930556J24Rik'
ID44000
Institutional Source Beutler Lab
Gene Symbol 4930556J24Rik
Ensembl Gene ENSMUSG00000034493
Gene NameRIKEN cDNA 4930556J24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location3937541-3976778 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 3938178 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042344]
Predicted Effect probably null
Transcript: ENSMUST00000042344
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in 4930556J24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:4930556J24Rik APN 11 3937974 missense unknown
P4748:4930556J24Rik UTSW 11 3938178 splice site probably null
R0478:4930556J24Rik UTSW 11 3976259 intron probably benign
R5593:4930556J24Rik UTSW 11 3938027 missense unknown
R5594:4930556J24Rik UTSW 11 3938027 missense unknown
R5698:4930556J24Rik UTSW 11 3976366 missense possibly damaging 0.93
R6081:4930556J24Rik UTSW 11 3938140 missense unknown
R6169:4930556J24Rik UTSW 11 3938005 missense unknown
R6626:4930556J24Rik UTSW 11 3938056 missense unknown
T0975:4930556J24Rik UTSW 11 3937945 frame shift probably null
T0975:4930556J24Rik UTSW 11 3976324 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGTCTCCCGTGAGGAACTCTAC -3'
(R):5'- TGCCCTTAGATGTGCCTACCTAACC -3'

Sequencing Primer
(F):5'- GGACACTAACATATCTTGCTTGC -3'
(R):5'- cttccttcaccgagatgcc -3'
Posted On2013-05-31