Incidental Mutation 'R5634:Gm14025'
ID 440019
Institutional Source Beutler Lab
Gene Symbol Gm14025
Ensembl Gene ENSMUSG00000079051
Gene Name predicted gene 14025
Synonyms
MMRRC Submission 043285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5634 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 129025073-129048172 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129039486 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 173 (D173E)
Ref Sequence ENSEMBL: ENSMUSP00000123404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145798]
AlphaFold A2AP89
Predicted Effect probably benign
Transcript: ENSMUST00000145798
AA Change: D173E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123404
Gene: ENSMUSG00000079051
AA Change: D173E

DomainStartEndE-ValueType
Pfam:Vinculin 14 248 5.8e-18 PFAM
Pfam:Vinculin 281 619 2.1e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,621 probably benign Het
Aen A T 7: 78,902,507 T34S probably benign Het
Apoh T A 11: 108,412,049 V280E probably damaging Het
Ccdc87 A G 19: 4,840,665 H395R probably benign Het
Ccrl2 T A 9: 111,055,987 probably null Het
Cdh20 T C 1: 104,975,075 F497S probably damaging Het
Cfap54 C A 10: 92,904,263 probably benign Het
Cipc T A 12: 86,952,975 probably null Het
Col14a1 T A 15: 55,518,298 Y1756N probably damaging Het
Cyp2c54 G A 19: 40,072,414 A95V possibly damaging Het
Dcdc5 A G 2: 106,403,980 noncoding transcript Het
Dnah17 T C 11: 118,052,926 probably null Het
Eepd1 A T 9: 25,603,553 N552I probably benign Het
Eif2ak4 A T 2: 118,462,311 R1218W probably damaging Het
Fbxw18 T A 9: 109,676,803 I467F possibly damaging Het
Ffar4 GCTTCTT GCTT 19: 38,113,925 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm884 T C 11: 103,542,014 N1267S possibly damaging Het
Gpha2 A G 19: 6,226,860 T25A probably benign Het
Grin3a T A 4: 49,792,843 I297F probably damaging Het
Herc2 G A 7: 56,206,783 G3924R probably damaging Het
Hmcn2 G T 2: 31,333,881 D97Y probably damaging Het
Igdcc4 G A 9: 65,134,546 G1131D probably benign Het
Il18rap T C 1: 40,539,376 probably benign Het
Ino80d C A 1: 63,062,283 probably benign Het
Klhl1 T C 14: 96,240,271 T454A probably damaging Het
Krt84 C A 15: 101,528,649 V360L probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mapkbp1 A G 2: 119,973,095 N15S probably damaging Het
Med13l T C 5: 118,560,850 F22S possibly damaging Het
Mrc2 T A 11: 105,336,214 C548* probably null Het
Nacad T C 11: 6,602,387 E268G possibly damaging Het
Nfxl1 A G 5: 72,529,490 C527R probably damaging Het
Nphp1 A T 2: 127,759,650 C412S possibly damaging Het
Odf3b T A 15: 89,378,207 T70S probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1279 A G 2: 111,307,092 I296V probably benign Het
Per2 C T 1: 91,444,707 C215Y probably benign Het
Pias1 T C 9: 62,895,973 T343A probably benign Het
Pja2 C T 17: 64,292,867 V541M probably damaging Het
Plxna4 G A 6: 32,237,723 Q608* probably null Het
Ppil4 T A 10: 7,814,778 D398E probably benign Het
Ppp4r3a T A 12: 101,043,521 D8V probably damaging Het
Pstk A C 7: 131,371,343 D57A probably damaging Het
Ptprd T C 4: 76,072,018 I53V probably benign Het
Pyroxd2 A G 19: 42,740,485 F159L probably benign Het
Rnf103 A G 6: 71,509,617 M411V probably benign Het
Scn4a T C 11: 106,330,004 D943G probably benign Het
Sdk2 T C 11: 113,851,714 T790A probably damaging Het
Sfr1 T C 19: 47,733,871 L242P probably damaging Het
Snx25 T C 8: 46,041,391 D819G possibly damaging Het
Sult2b1 A G 7: 45,734,082 V183A probably damaging Het
Tcf4 C A 18: 69,636,847 S8R possibly damaging Het
Ttc7 A G 17: 87,342,087 D531G probably benign Het
Uap1l1 A C 2: 25,364,133 C271G probably damaging Het
Ubtf T C 11: 102,310,324 Y268C probably damaging Het
Zfp951 A T 5: 104,815,289 M137K probably benign Het
Other mutations in Gm14025
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Gm14025 APN 2 129038702 missense probably benign 0.01
IGL02423:Gm14025 APN 2 129048048 missense probably benign 0.03
IGL02730:Gm14025 APN 2 129038726 missense possibly damaging 0.57
PIT4677001:Gm14025 UTSW 2 129038716 missense
R0019:Gm14025 UTSW 2 129039026 missense probably benign 0.26
R3946:Gm14025 UTSW 2 129039601 missense probably damaging 1.00
R4666:Gm14025 UTSW 2 129038230 missense probably benign 0.02
R4819:Gm14025 UTSW 2 129040801 missense probably damaging 0.96
R6019:Gm14025 UTSW 2 129037690 missense probably benign
R6241:Gm14025 UTSW 2 129037381 missense possibly damaging 0.87
R6285:Gm14025 UTSW 2 129037799 missense possibly damaging 0.82
R6377:Gm14025 UTSW 2 129036811 missense unknown
R6464:Gm14025 UTSW 2 129039545 missense possibly damaging 0.85
R6724:Gm14025 UTSW 2 129038056 missense probably benign 0.23
R7050:Gm14025 UTSW 2 129027971 splice site probably null
R7130:Gm14025 UTSW 2 129039181 missense
R7199:Gm14025 UTSW 2 129038318 missense
R7324:Gm14025 UTSW 2 129037852 missense unknown
R7355:Gm14025 UTSW 2 129037229 missense unknown
R7407:Gm14025 UTSW 2 129038809 missense
R7634:Gm14025 UTSW 2 129038272 missense
R7688:Gm14025 UTSW 2 129039044 nonsense probably null
R7889:Gm14025 UTSW 2 129036994 missense unknown
R7894:Gm14025 UTSW 2 129037129 missense unknown
R8242:Gm14025 UTSW 2 129039393 nonsense probably null
R8373:Gm14025 UTSW 2 129038171 missense
R8927:Gm14025 UTSW 2 129040869 missense
R8928:Gm14025 UTSW 2 129040869 missense
R9231:Gm14025 UTSW 2 129037420 missense unknown
R9504:Gm14025 UTSW 2 129039269 missense
R9505:Gm14025 UTSW 2 129036918 missense unknown
R9608:Gm14025 UTSW 2 129036630 nonsense probably null
R9682:Gm14025 UTSW 2 129033609 missense unknown
R9760:Gm14025 UTSW 2 129038579 missense
RF002:Gm14025 UTSW 2 129038794 missense
X0066:Gm14025 UTSW 2 129039067 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATTCTGAGAGAGCACTCCGGTC -3'
(R):5'- AGGCTTAAACTACGAGGCTCC -3'

Sequencing Primer
(F):5'- AGGAGCTCTTCGAGGCTCTG -3'
(R):5'- GAGGCTCCAAAAATGTCCAGTTATC -3'
Posted On 2016-11-08