Incidental Mutation 'P4717OSA:Bbof1'
ID44002
Institutional Source Beutler Lab
Gene Symbol Bbof1
Ensembl Gene ENSMUSG00000057265
Gene Namebasal body orientation factor 1
Synonyms2900006K08Rik, Ccdc176
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location84409071-84442887 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84426960 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 355 (A355T)
Ref Sequence ENSEMBL: ENSMUSP00000080512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081828] [ENSMUST00000085192] [ENSMUST00000151789] [ENSMUST00000153540]
Predicted Effect probably damaging
Transcript: ENSMUST00000081828
AA Change: A355T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080512
Gene: ENSMUSG00000057265
AA Change: A355T

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
Pfam:DUF4515 83 276 1.8e-44 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085192
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151789
SMART Domains Protein: ENSMUSP00000115708
Gene: ENSMUSG00000057265

DomainStartEndE-ValueType
Pfam:DUF4515 1 138 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153540
SMART Domains Protein: ENSMUSP00000114625
Gene: ENSMUSG00000057265

DomainStartEndE-ValueType
Pfam:DUF4515 1 105 3.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222641
Meta Mutation Damage Score 0.3766 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Bbof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Bbof1 APN 12 84411085 missense possibly damaging 0.92
IGL02572:Bbof1 APN 12 84428365 missense probably damaging 1.00
IGL02933:Bbof1 APN 12 84426966 missense probably damaging 1.00
IGL03099:Bbof1 APN 12 84426765 nonsense probably null
R0100:Bbof1 UTSW 12 84411055 missense probably benign 0.00
R0100:Bbof1 UTSW 12 84411055 missense probably benign 0.00
R0230:Bbof1 UTSW 12 84425204 missense probably damaging 1.00
R0511:Bbof1 UTSW 12 84430271 missense probably benign 0.02
R1506:Bbof1 UTSW 12 84423499 missense probably damaging 0.97
R1920:Bbof1 UTSW 12 84411085 missense possibly damaging 0.92
R2097:Bbof1 UTSW 12 84413307 missense probably damaging 1.00
R2355:Bbof1 UTSW 12 84423449 missense probably damaging 1.00
R3935:Bbof1 UTSW 12 84411210 missense probably damaging 1.00
R4210:Bbof1 UTSW 12 84409183 start codon destroyed probably null
R4321:Bbof1 UTSW 12 84427128 nonsense probably null
R5001:Bbof1 UTSW 12 84426856 missense possibly damaging 0.80
R5033:Bbof1 UTSW 12 84411270 splice site probably null
R5244:Bbof1 UTSW 12 84430073 missense possibly damaging 0.56
R6169:Bbof1 UTSW 12 84426814 missense probably benign 0.02
R6295:Bbof1 UTSW 12 84411168 missense possibly damaging 0.58
R7073:Bbof1 UTSW 12 84426835 missense probably damaging 1.00
R7895:Bbof1 UTSW 12 84419989 missense probably damaging 0.98
R8050:Bbof1 UTSW 12 84411217 missense probably benign 0.01
R8163:Bbof1 UTSW 12 84426762 missense possibly damaging 0.93
R8398:Bbof1 UTSW 12 84428414 missense probably damaging 1.00
X0019:Bbof1 UTSW 12 84426793 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAGAACGCTCTGACCTACATGAC -3'
(R):5'- TATGGCATGAGCCACCACAACCTG -3'

Sequencing Primer
(F):5'- TGACCTACATGACCACAGAGTTTG -3'
(R):5'- AGAGATCCTGGTTCACACTATTGG -3'
Posted On2013-05-31