Incidental Mutation 'R5634:Aen'
ID 440029
Institutional Source Beutler Lab
Gene Symbol Aen
Ensembl Gene ENSMUSG00000030609
Gene Name apoptosis enhancing nuclease
Synonyms Isg20l1, 2700083B06Rik
MMRRC Submission 043285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R5634 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 78895854-78911209 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78902507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 34 (T34S)
Ref Sequence ENSEMBL: ENSMUSP00000117331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107421] [ENSMUST00000107423] [ENSMUST00000107425] [ENSMUST00000138167] [ENSMUST00000205861] [ENSMUST00000205882]
AlphaFold Q9CZI9
Predicted Effect probably benign
Transcript: ENSMUST00000107421
AA Change: T34S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103044
Gene: ENSMUSG00000030609
AA Change: T34S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
EXOIII 70 236 2.04e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107423
AA Change: T72S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103046
Gene: ENSMUSG00000030609
AA Change: T72S

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107425
AA Change: T72S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103048
Gene: ENSMUSG00000030609
AA Change: T72S

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123824
Predicted Effect probably benign
Transcript: ENSMUST00000138167
AA Change: T34S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117331
Gene: ENSMUSG00000030609
AA Change: T34S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
Pfam:RNase_T 72 138 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172017
Predicted Effect probably benign
Transcript: ENSMUST00000205861
Predicted Effect probably benign
Transcript: ENSMUST00000205882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206661
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,621 probably benign Het
Apoh T A 11: 108,412,049 V280E probably damaging Het
Ccdc87 A G 19: 4,840,665 H395R probably benign Het
Ccrl2 T A 9: 111,055,987 probably null Het
Cdh20 T C 1: 104,975,075 F497S probably damaging Het
Cfap54 C A 10: 92,904,263 probably benign Het
Cipc T A 12: 86,952,975 probably null Het
Col14a1 T A 15: 55,518,298 Y1756N probably damaging Het
Cyp2c54 G A 19: 40,072,414 A95V possibly damaging Het
Dcdc5 A G 2: 106,403,980 noncoding transcript Het
Dnah17 T C 11: 118,052,926 probably null Het
Eepd1 A T 9: 25,603,553 N552I probably benign Het
Eif2ak4 A T 2: 118,462,311 R1218W probably damaging Het
Fbxw18 T A 9: 109,676,803 I467F possibly damaging Het
Ffar4 GCTTCTT GCTT 19: 38,113,925 probably benign Het
Gm14025 A T 2: 129,039,486 D173E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm884 T C 11: 103,542,014 N1267S possibly damaging Het
Gpha2 A G 19: 6,226,860 T25A probably benign Het
Grin3a T A 4: 49,792,843 I297F probably damaging Het
Herc2 G A 7: 56,206,783 G3924R probably damaging Het
Hmcn2 G T 2: 31,333,881 D97Y probably damaging Het
Igdcc4 G A 9: 65,134,546 G1131D probably benign Het
Il18rap T C 1: 40,539,376 probably benign Het
Ino80d C A 1: 63,062,283 probably benign Het
Klhl1 T C 14: 96,240,271 T454A probably damaging Het
Krt84 C A 15: 101,528,649 V360L probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mapkbp1 A G 2: 119,973,095 N15S probably damaging Het
Med13l T C 5: 118,560,850 F22S possibly damaging Het
Mrc2 T A 11: 105,336,214 C548* probably null Het
Nacad T C 11: 6,602,387 E268G possibly damaging Het
Nfxl1 A G 5: 72,529,490 C527R probably damaging Het
Nphp1 A T 2: 127,759,650 C412S possibly damaging Het
Odf3b T A 15: 89,378,207 T70S probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1279 A G 2: 111,307,092 I296V probably benign Het
Per2 C T 1: 91,444,707 C215Y probably benign Het
Pias1 T C 9: 62,895,973 T343A probably benign Het
Pja2 C T 17: 64,292,867 V541M probably damaging Het
Plxna4 G A 6: 32,237,723 Q608* probably null Het
Ppil4 T A 10: 7,814,778 D398E probably benign Het
Ppp4r3a T A 12: 101,043,521 D8V probably damaging Het
Pstk A C 7: 131,371,343 D57A probably damaging Het
Ptprd T C 4: 76,072,018 I53V probably benign Het
Pyroxd2 A G 19: 42,740,485 F159L probably benign Het
Rnf103 A G 6: 71,509,617 M411V probably benign Het
Scn4a T C 11: 106,330,004 D943G probably benign Het
Sdk2 T C 11: 113,851,714 T790A probably damaging Het
Sfr1 T C 19: 47,733,871 L242P probably damaging Het
Snx25 T C 8: 46,041,391 D819G possibly damaging Het
Sult2b1 A G 7: 45,734,082 V183A probably damaging Het
Tcf4 C A 18: 69,636,847 S8R possibly damaging Het
Ttc7 A G 17: 87,342,087 D531G probably benign Het
Uap1l1 A C 2: 25,364,133 C271G probably damaging Het
Ubtf T C 11: 102,310,324 Y268C probably damaging Het
Zfp951 A T 5: 104,815,289 M137K probably benign Het
Other mutations in Aen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Aen APN 7 78907302 missense probably damaging 0.96
IGL01062:Aen APN 7 78907302 missense probably damaging 0.96
IGL01065:Aen APN 7 78907302 missense probably damaging 0.96
IGL01067:Aen APN 7 78907302 missense probably damaging 0.96
IGL01068:Aen APN 7 78907302 missense probably damaging 0.96
IGL01069:Aen APN 7 78907302 missense probably damaging 0.96
IGL01070:Aen APN 7 78907302 missense probably damaging 0.96
IGL01086:Aen APN 7 78907302 missense probably damaging 0.96
IGL01089:Aen APN 7 78907302 missense probably damaging 0.96
IGL01126:Aen APN 7 78907302 missense probably damaging 0.96
IGL01128:Aen APN 7 78907302 missense probably damaging 0.96
IGL01133:Aen APN 7 78907302 missense probably damaging 0.96
IGL01134:Aen APN 7 78907302 missense probably damaging 0.96
IGL01147:Aen APN 7 78907302 missense probably damaging 0.96
R1433:Aen UTSW 7 78907312 missense probably damaging 1.00
R1543:Aen UTSW 7 78902622 missense probably damaging 1.00
R1615:Aen UTSW 7 78905912 missense probably damaging 1.00
R1886:Aen UTSW 7 78907325 missense probably damaging 0.98
R1887:Aen UTSW 7 78907325 missense probably damaging 0.98
R1918:Aen UTSW 7 78906029 missense possibly damaging 0.96
R1919:Aen UTSW 7 78905912 missense probably damaging 1.00
R1946:Aen UTSW 7 78902672 missense probably damaging 1.00
R2192:Aen UTSW 7 78906045 critical splice donor site probably null
R2224:Aen UTSW 7 78902451 missense probably benign 0.30
R2225:Aen UTSW 7 78902451 missense probably benign 0.30
R2226:Aen UTSW 7 78902451 missense probably benign 0.30
R2244:Aen UTSW 7 78907297 missense probably damaging 1.00
R2516:Aen UTSW 7 78905868 missense probably damaging 1.00
R4943:Aen UTSW 7 78902361 missense probably damaging 0.99
R5834:Aen UTSW 7 78907301 missense probably damaging 1.00
R5961:Aen UTSW 7 78907159 missense probably damaging 1.00
R6130:Aen UTSW 7 78902639 splice site probably null
R6255:Aen UTSW 7 78905844 missense probably damaging 1.00
R6400:Aen UTSW 7 78907394 missense probably benign 0.02
R7303:Aen UTSW 7 78902456 missense possibly damaging 0.77
R8207:Aen UTSW 7 78902743 missense possibly damaging 0.55
R8476:Aen UTSW 7 78907199 missense probably damaging 1.00
R9230:Aen UTSW 7 78902359 missense probably damaging 0.96
Z1177:Aen UTSW 7 78902766 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGCCTGAATACCAAGGATG -3'
(R):5'- TCAGGCCGGATGTATTTGTC -3'

Sequencing Primer
(F):5'- CCAAGGATGTGGTTCGGAG -3'
(R):5'- TGTCATAGAGAACGTCACCACTGTAG -3'
Posted On 2016-11-08