Incidental Mutation 'R5634:Ccrl2'
ID440037
Institutional Source Beutler Lab
Gene Symbol Ccrl2
Ensembl Gene ENSMUSG00000043953
Gene Namechemokine (C-C motif) receptor-like 2
SynonymsCCR11, Cmkbr1l2, L-CCR
MMRRC Submission 043285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5634 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111054486-111057519 bp(-) (GRCm38)
Type of Mutationsplice site (43 bp from exon)
DNA Base Change (assembly) T to A at 111055987 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111888] [ENSMUST00000195968] [ENSMUST00000199839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111888
AA Change: T148S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107519
Gene: ENSMUSG00000043953
AA Change: T148S

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 6e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195968
SMART Domains Protein: ENSMUSP00000143105
Gene: ENSMUSG00000043953

DomainStartEndE-ValueType
Pfam:7tm_1 54 130 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197851
Predicted Effect possibly damaging
Transcript: ENSMUST00000199839
AA Change: T148S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143116
Gene: ENSMUSG00000043953
AA Change: T148S

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 4.2e-31 PFAM
Meta Mutation Damage Score 0.6124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,621 probably benign Het
Aen A T 7: 78,902,507 T34S probably benign Het
Apoh T A 11: 108,412,049 V280E probably damaging Het
Ccdc87 A G 19: 4,840,665 H395R probably benign Het
Cdh20 T C 1: 104,975,075 F497S probably damaging Het
Cfap54 C A 10: 92,904,263 probably benign Het
Cipc T A 12: 86,952,975 probably null Het
Col14a1 T A 15: 55,518,298 Y1756N probably damaging Het
Cyp2c54 G A 19: 40,072,414 A95V possibly damaging Het
Dcdc5 A G 2: 106,403,980 noncoding transcript Het
Dnah17 T C 11: 118,052,926 probably null Het
Eepd1 A T 9: 25,603,553 N552I probably benign Het
Eif2ak4 A T 2: 118,462,311 R1218W probably damaging Het
Fbxw18 T A 9: 109,676,803 I467F possibly damaging Het
Ffar4 GCTTCTT GCTT 19: 38,113,925 probably benign Het
Gm14025 A T 2: 129,039,486 D173E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm884 T C 11: 103,542,014 N1267S possibly damaging Het
Gpha2 A G 19: 6,226,860 T25A probably benign Het
Grin3a T A 4: 49,792,843 I297F probably damaging Het
Herc2 G A 7: 56,206,783 G3924R probably damaging Het
Hmcn2 G T 2: 31,333,881 D97Y probably damaging Het
Igdcc4 G A 9: 65,134,546 G1131D probably benign Het
Il18rap T C 1: 40,539,376 probably benign Het
Ino80d C A 1: 63,062,283 probably benign Het
Klhl1 T C 14: 96,240,271 T454A probably damaging Het
Krt84 C A 15: 101,528,649 V360L probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mapkbp1 A G 2: 119,973,095 N15S probably damaging Het
Med13l T C 5: 118,560,850 F22S possibly damaging Het
Mrc2 T A 11: 105,336,214 C548* probably null Het
Nacad T C 11: 6,602,387 E268G possibly damaging Het
Nfxl1 A G 5: 72,529,490 C527R probably damaging Het
Nphp1 A T 2: 127,759,650 C412S possibly damaging Het
Odf3b T A 15: 89,378,207 T70S probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1279 A G 2: 111,307,092 I296V probably benign Het
Per2 C T 1: 91,444,707 C215Y probably benign Het
Pias1 T C 9: 62,895,973 T343A probably benign Het
Pja2 C T 17: 64,292,867 V541M probably damaging Het
Plxna4 G A 6: 32,237,723 Q608* probably null Het
Ppil4 T A 10: 7,814,778 D398E probably benign Het
Ppp4r3a T A 12: 101,043,521 D8V probably damaging Het
Pstk A C 7: 131,371,343 D57A probably damaging Het
Ptprd T C 4: 76,072,018 I53V probably benign Het
Pyroxd2 A G 19: 42,740,485 F159L probably benign Het
Rnf103 A G 6: 71,509,617 M411V probably benign Het
Scn4a T C 11: 106,330,004 D943G probably benign Het
Sdk2 T C 11: 113,851,714 T790A probably damaging Het
Sfr1 T C 19: 47,733,871 L242P probably damaging Het
Snx25 T C 8: 46,041,391 D819G possibly damaging Het
Sult2b1 A G 7: 45,734,082 V183A probably damaging Het
Tcf4 C A 18: 69,636,847 S8R possibly damaging Het
Ttc7 A G 17: 87,342,087 D531G probably benign Het
Uap1l1 A C 2: 25,364,133 C271G probably damaging Het
Ubtf T C 11: 102,310,324 Y268C probably damaging Het
Zfp951 A T 5: 104,815,289 M137K probably benign Het
Other mutations in Ccrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02382:Ccrl2 APN 9 111055879 missense probably benign 0.22
IGL02492:Ccrl2 APN 9 111055803 missense probably benign 0.01
octomom UTSW 9 111055987 splice site probably null
IGL03134:Ccrl2 UTSW 9 111055657 missense probably damaging 1.00
R0321:Ccrl2 UTSW 9 111056211 missense probably damaging 0.97
R0924:Ccrl2 UTSW 9 111055968 missense probably benign 0.39
R0967:Ccrl2 UTSW 9 111055686 missense probably benign 0.02
R2033:Ccrl2 UTSW 9 111055870 missense possibly damaging 0.95
R3720:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R3721:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R4244:Ccrl2 UTSW 9 111055354 missense probably benign 0.33
R7027:Ccrl2 UTSW 9 111055885 missense probably benign 0.11
R7060:Ccrl2 UTSW 9 111055614 missense probably damaging 1.00
R8957:Ccrl2 UTSW 9 111055489 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACGTACTTCCAGAGCGG -3'
(R):5'- CTGGGGAACATCTACTTCCTAAACC -3'

Sequencing Primer
(F):5'- GCGCTTCGATTGGCAAG -3'
(R):5'- TAAACCTGGCACTTTCAAACCTGTG -3'
Posted On2016-11-08