Incidental Mutation 'R5512:Masp2'
ID440079
Institutional Source Beutler Lab
Gene Symbol Masp2
Ensembl Gene ENSMUSG00000028979
Gene Namemannan-binding lectin serine peptidase 2
SynonymsMASP-2, MAp19
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R5512 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148602554-148615499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148614069 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 536 (I536F)
Ref Sequence ENSEMBL: ENSMUSP00000049729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045180] [ENSMUST00000052060] [ENSMUST00000084125] [ENSMUST00000095719] [ENSMUST00000105699] [ENSMUST00000105700] [ENSMUST00000105702] [ENSMUST00000140897] [ENSMUST00000165113] [ENSMUST00000186729] [ENSMUST00000188134] [ENSMUST00000172073] [ENSMUST00000190696] [ENSMUST00000191450] [ENSMUST00000187939] [ENSMUST00000186711] [ENSMUST00000189048] [ENSMUST00000186947] [ENSMUST00000190552]
Predicted Effect probably benign
Transcript: ENSMUST00000045180
SMART Domains Protein: ENSMUSP00000038113
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052060
AA Change: I536F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049729
Gene: ENSMUSG00000028979
AA Change: I536F

DomainStartEndE-ValueType
CUB 18 137 4.71e-30 SMART
EGF_CA 138 181 4.32e-10 SMART
CUB 184 296 4.29e-33 SMART
CCP 300 361 1.79e-12 SMART
CCP 366 429 5.4e-7 SMART
Tryp_SPc 443 678 1.3e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084125
SMART Domains Protein: ENSMUSP00000081142
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 273 316 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095719
SMART Domains Protein: ENSMUSP00000093386
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105699
SMART Domains Protein: ENSMUSP00000101324
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105700
SMART Domains Protein: ENSMUSP00000101325
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105702
SMART Domains Protein: ENSMUSP00000101327
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140897
SMART Domains Protein: ENSMUSP00000135135
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Blast:RRM_2 1 28 2e-13 BLAST
RRM 44 110 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154898
Predicted Effect probably benign
Transcript: ENSMUST00000165113
SMART Domains Protein: ENSMUSP00000129342
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188380
Predicted Effect probably benign
Transcript: ENSMUST00000186729
SMART Domains Protein: ENSMUSP00000139547
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Pfam:RRM_1 1 37 1.8e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188134
SMART Domains Protein: ENSMUSP00000139476
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188488
Predicted Effect probably benign
Transcript: ENSMUST00000172073
SMART Domains Protein: ENSMUSP00000130963
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
low complexity region 274 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190630
Predicted Effect probably benign
Transcript: ENSMUST00000190696
SMART Domains Protein: ENSMUSP00000139637
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
Blast:RRM_2 55 79 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191450
SMART Domains Protein: ENSMUSP00000140832
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 5.8e-20 SMART
RRM 192 258 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187939
SMART Domains Protein: ENSMUSP00000140928
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 18 84 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186711
Predicted Effect probably benign
Transcript: ENSMUST00000189048
SMART Domains Protein: ENSMUSP00000140364
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 1.38e-17 SMART
RRM 192 258 7.03e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191378
Predicted Effect probably benign
Transcript: ENSMUST00000186947
SMART Domains Protein: ENSMUSP00000140529
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM 105 176 5.8e-20 SMART
low complexity region 215 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190287
Predicted Effect probably benign
Transcript: ENSMUST00000185824
Predicted Effect probably benign
Transcript: ENSMUST00000190552
SMART Domains Protein: ENSMUSP00000141052
Gene: ENSMUSG00000041459

DomainStartEndE-ValueType
RRM_2 1 56 6.1e-4 SMART
RRM 72 138 3e-12 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous disruption of the exon encoding the small mannose-binding lectin (MBL)-associated protein results in a defective lectin-mediated complement pathway with a 20% reduction in the ability of serum components to cleave C3 and C4 in the presence of mannose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,350,660 V364A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Adgre5 T C 8: 83,729,086 N198D probably benign Het
Adgrf4 G T 17: 42,667,285 T389K probably benign Het
Apc T A 18: 34,310,909 probably benign Het
Appl2 T A 10: 83,605,818 I524F probably damaging Het
Arhgef37 G A 18: 61,499,774 Q531* probably null Het
Atp7b T C 8: 22,012,739 T694A probably benign Het
Cacna1g T A 11: 94,444,142 I780F probably damaging Het
Calcoco2 T C 11: 96,103,336 K95E probably damaging Het
Cars T C 7: 143,570,133 D388G possibly damaging Het
Ccdc150 A C 1: 54,354,647 E690A probably damaging Het
Cdc73 G T 1: 143,702,616 D3E probably damaging Het
Cdh23 C A 10: 60,534,386 probably null Het
Cep170b T C 12: 112,733,485 S143P possibly damaging Het
Cherp T C 8: 72,463,266 I607V possibly damaging Het
CN725425 T A 15: 91,240,756 H166Q probably benign Het
Dcaf6 A G 1: 165,399,835 V241A possibly damaging Het
Dot1l C T 10: 80,788,991 P881S possibly damaging Het
Dsg1c A T 18: 20,272,511 N327I probably damaging Het
Fam208b A T 13: 3,595,517 Y111N probably damaging Het
Fbxw7 G A 3: 84,954,909 R182H probably damaging Het
Fkbp1b A T 12: 4,838,183 V24E probably benign Het
Fut11 T C 14: 20,696,001 S304P probably damaging Het
Ggt1 C T 10: 75,584,884 T361I probably damaging Het
Gimap7 G T 6: 48,723,596 A39S probably benign Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Gm17541 G T 12: 4,689,452 probably benign Het
Gmip T A 8: 69,817,890 V750E probably benign Het
Gna14 A G 19: 16,608,128 E290G probably benign Het
Gpnmb T C 6: 49,045,464 V176A possibly damaging Het
Hhla1 T C 15: 65,924,016 K447R probably benign Het
Hsd3b1 A G 3: 98,853,205 Y157H probably benign Het
Iqgap2 G A 13: 95,675,376 Q706* probably null Het
Krt222 A C 11: 99,234,955 S283R probably damaging Het
Ldb2 G A 5: 44,480,244 R241W probably damaging Het
Lrrc8d C G 5: 105,812,784 F353L probably damaging Het
Lrrc8d G A 5: 105,812,785 E354K probably benign Het
Mptx1 A G 1: 174,332,749 D207G probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Napsa A G 7: 44,572,616 M1V probably null Het
Ncam1 A T 9: 49,509,699 probably null Het
Nckap5 G A 1: 126,027,744 P425L possibly damaging Het
Nol8 A G 13: 49,676,787 S1116G probably benign Het
Nrde2 G T 12: 100,142,250 Q361K probably benign Het
Nudt13 G A 14: 20,307,732 G133D probably damaging Het
Ofcc1 G T 13: 40,206,810 Q248K probably benign Het
Olfm4 A G 14: 80,021,347 D345G probably benign Het
Olfr1287 G A 2: 111,449,754 V205I probably benign Het
Olfr720 C A 14: 14,175,633 G150C probably damaging Het
Osbpl3 T G 6: 50,309,360 K659N probably damaging Het
Pdk2 G A 11: 95,039,466 T48M probably damaging Het
Phf11a A T 14: 59,287,550 D68E probably benign Het
Prrxl1 A G 14: 32,600,044 H5R probably damaging Het
Purb A G 11: 6,475,702 V62A probably damaging Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Rtl1 C T 12: 109,591,371 E1345K unknown Het
Sema3e G A 5: 14,230,180 A358T probably damaging Het
Slc29a2 A G 19: 5,026,398 I105V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc6a5 G A 7: 49,941,825 V513I probably damaging Het
Slco4a1 T A 2: 180,474,114 F681Y possibly damaging Het
Sp1 A G 15: 102,431,010 N775S possibly damaging Het
Sspo T A 6: 48,455,671 V827D probably damaging Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tars2 A T 3: 95,750,416 C238S probably damaging Het
Tnks1bp1 C A 2: 85,062,834 P373Q probably benign Het
Tnpo3 A G 6: 29,575,046 L373P probably damaging Het
Unc45b A C 11: 82,915,072 D135A possibly damaging Het
Vmn1r235 A T 17: 21,261,415 M1L probably benign Het
Vmn2r66 T C 7: 85,007,941 I85M probably damaging Het
Vmn2r80 T G 10: 79,168,232 L93W probably benign Het
Vwf G T 6: 125,673,887 probably benign Het
Ythdf3 A G 3: 16,183,922 R9G probably damaging Het
Zfp229 A G 17: 21,745,036 probably null Het
Zfp958 A C 8: 4,625,838 probably null Het
Other mutations in Masp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Masp2 APN 4 148602729 missense probably benign 0.05
IGL01284:Masp2 APN 4 148614007 missense probably damaging 1.00
IGL02040:Masp2 APN 4 148603813 missense probably damaging 1.00
IGL02243:Masp2 APN 4 148603068 missense probably benign 0.32
IGL02490:Masp2 APN 4 148607943 missense possibly damaging 0.91
IGL02517:Masp2 APN 4 148614020 missense probably damaging 1.00
IGL02997:Masp2 APN 4 148603175 splice site probably benign
R0408:Masp2 UTSW 4 148606039 missense probably benign
R1517:Masp2 UTSW 4 148612106 missense possibly damaging 0.74
R1630:Masp2 UTSW 4 148614033 missense probably benign 0.07
R1634:Masp2 UTSW 4 148614355 missense probably damaging 1.00
R1873:Masp2 UTSW 4 148614495 missense probably damaging 1.00
R2208:Masp2 UTSW 4 148614415 missense probably damaging 1.00
R2283:Masp2 UTSW 4 148606068 missense probably benign 0.00
R2876:Masp2 UTSW 4 148608001 missense probably benign
R3921:Masp2 UTSW 4 148605731 missense possibly damaging 0.95
R4586:Masp2 UTSW 4 148613901 missense probably damaging 1.00
R4753:Masp2 UTSW 4 148612151 missense probably benign 0.00
R4877:Masp2 UTSW 4 148602871 missense probably benign 0.00
R5169:Masp2 UTSW 4 148606114 missense probably damaging 0.96
R6161:Masp2 UTSW 4 148614012 missense possibly damaging 0.88
R6291:Masp2 UTSW 4 148602753 missense probably damaging 0.99
R7039:Masp2 UTSW 4 148602586 start codon destroyed probably benign 0.03
R7164:Masp2 UTSW 4 148610115 critical splice acceptor site probably null
R7183:Masp2 UTSW 4 148612157 missense probably benign 0.02
R7417:Masp2 UTSW 4 148605721 missense probably benign 0.02
R7718:Masp2 UTSW 4 148602747 missense probably damaging 1.00
R7748:Masp2 UTSW 4 148605706 missense probably benign 0.00
R7852:Masp2 UTSW 4 148602732 missense probably benign 0.00
R7986:Masp2 UTSW 4 148602826 missense probably damaging 1.00
R8078:Masp2 UTSW 4 148613778 missense probably benign 0.01
R8203:Masp2 UTSW 4 148612142 missense probably benign 0.00
R8257:Masp2 UTSW 4 148603040 missense possibly damaging 0.82
X0025:Masp2 UTSW 4 148602723 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTCAAACTACAGCAGCAG -3'
(R):5'- TGGTCAGCAATTGGTATGTCC -3'

Sequencing Primer
(F):5'- TGACAATTGGGTCCTAACAGCCG -3'
(R):5'- GTCCACAAACATTAGGTTTCTAGC -3'
Posted On2016-11-08