Incidental Mutation 'P4717OSA:Mylk'
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Namemyosin, light polypeptide kinase
SynonymsMlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosomal Location34745210-35002420 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 34977113 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
Predicted Effect probably benign
Transcript: ENSMUST00000023538
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836

IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtcattatcatcatcatcatcacc -3'
Posted On2013-05-31